ID: 1137489200

View in Genome Browser
Species Human (GRCh38)
Location 16:48916969-48916991
Sequence AGCCCCCTGGAAAATGGTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137489196_1137489200 9 Left 1137489196 16:48916937-48916959 CCTGTGCAGCTGACAGGTTCAAC No data
Right 1137489200 16:48916969-48916991 AGCCCCCTGGAAAATGGTGTAGG No data
1137489192_1137489200 27 Left 1137489192 16:48916919-48916941 CCCTGGCTTACTGCTAGCCCTGT No data
Right 1137489200 16:48916969-48916991 AGCCCCCTGGAAAATGGTGTAGG No data
1137489195_1137489200 10 Left 1137489195 16:48916936-48916958 CCCTGTGCAGCTGACAGGTTCAA No data
Right 1137489200 16:48916969-48916991 AGCCCCCTGGAAAATGGTGTAGG No data
1137489193_1137489200 26 Left 1137489193 16:48916920-48916942 CCTGGCTTACTGCTAGCCCTGTG No data
Right 1137489200 16:48916969-48916991 AGCCCCCTGGAAAATGGTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137489200 Original CRISPR AGCCCCCTGGAAAATGGTGT AGG Intergenic
No off target data available for this crispr