ID: 1137492343

View in Genome Browser
Species Human (GRCh38)
Location 16:48943714-48943736
Sequence TCCTCAGCAGGAGGGCTCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137492338_1137492343 14 Left 1137492338 16:48943677-48943699 CCATGACACAGAAAGGCAGAGGA No data
Right 1137492343 16:48943714-48943736 TCCTCAGCAGGAGGGCTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137492343 Original CRISPR TCCTCAGCAGGAGGGCTCCA AGG Intergenic