ID: 1137492552

View in Genome Browser
Species Human (GRCh38)
Location 16:48945031-48945053
Sequence GGAAGGAAGAAGTGTCAGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137492552_1137492563 5 Left 1137492552 16:48945031-48945053 CCCTACTGACACTTCTTCCTTCC No data
Right 1137492563 16:48945059-48945081 TCAGTTGGGAGTTCTTAGGAGGG No data
1137492552_1137492566 10 Left 1137492552 16:48945031-48945053 CCCTACTGACACTTCTTCCTTCC No data
Right 1137492566 16:48945064-48945086 TGGGAGTTCTTAGGAGGGGAGGG No data
1137492552_1137492556 -9 Left 1137492552 16:48945031-48945053 CCCTACTGACACTTCTTCCTTCC No data
Right 1137492556 16:48945045-48945067 CTTCCTTCCCCAGGTCAGTTGGG No data
1137492552_1137492565 9 Left 1137492552 16:48945031-48945053 CCCTACTGACACTTCTTCCTTCC No data
Right 1137492565 16:48945063-48945085 TTGGGAGTTCTTAGGAGGGGAGG No data
1137492552_1137492562 4 Left 1137492552 16:48945031-48945053 CCCTACTGACACTTCTTCCTTCC No data
Right 1137492562 16:48945058-48945080 GTCAGTTGGGAGTTCTTAGGAGG No data
1137492552_1137492561 1 Left 1137492552 16:48945031-48945053 CCCTACTGACACTTCTTCCTTCC No data
Right 1137492561 16:48945055-48945077 CAGGTCAGTTGGGAGTTCTTAGG No data
1137492552_1137492564 6 Left 1137492552 16:48945031-48945053 CCCTACTGACACTTCTTCCTTCC No data
Right 1137492564 16:48945060-48945082 CAGTTGGGAGTTCTTAGGAGGGG No data
1137492552_1137492555 -10 Left 1137492552 16:48945031-48945053 CCCTACTGACACTTCTTCCTTCC No data
Right 1137492555 16:48945044-48945066 TCTTCCTTCCCCAGGTCAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137492552 Original CRISPR GGAAGGAAGAAGTGTCAGTA GGG (reversed) Intergenic
No off target data available for this crispr