ID: 1137495360

View in Genome Browser
Species Human (GRCh38)
Location 16:48965260-48965282
Sequence CCGCTGGGTCCAAGGCAATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137495360_1137495374 30 Left 1137495360 16:48965260-48965282 CCCCATTGCCTTGGACCCAGCGG No data
Right 1137495374 16:48965313-48965335 CTGTGTAGACAGATGAAGGAGGG No data
1137495360_1137495373 29 Left 1137495360 16:48965260-48965282 CCCCATTGCCTTGGACCCAGCGG No data
Right 1137495373 16:48965312-48965334 TCTGTGTAGACAGATGAAGGAGG No data
1137495360_1137495372 26 Left 1137495360 16:48965260-48965282 CCCCATTGCCTTGGACCCAGCGG No data
Right 1137495372 16:48965309-48965331 AACTCTGTGTAGACAGATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137495360 Original CRISPR CCGCTGGGTCCAAGGCAATG GGG (reversed) Intergenic
No off target data available for this crispr