ID: 1137495363

View in Genome Browser
Species Human (GRCh38)
Location 16:48965262-48965284
Sequence GACCGCTGGGTCCAAGGCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137495363_1137495372 24 Left 1137495363 16:48965262-48965284 CCATTGCCTTGGACCCAGCGGTC No data
Right 1137495372 16:48965309-48965331 AACTCTGTGTAGACAGATGAAGG No data
1137495363_1137495374 28 Left 1137495363 16:48965262-48965284 CCATTGCCTTGGACCCAGCGGTC No data
Right 1137495374 16:48965313-48965335 CTGTGTAGACAGATGAAGGAGGG No data
1137495363_1137495373 27 Left 1137495363 16:48965262-48965284 CCATTGCCTTGGACCCAGCGGTC No data
Right 1137495373 16:48965312-48965334 TCTGTGTAGACAGATGAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137495363 Original CRISPR GACCGCTGGGTCCAAGGCAA TGG (reversed) Intergenic
No off target data available for this crispr