ID: 1137495365

View in Genome Browser
Species Human (GRCh38)
Location 16:48965268-48965290
Sequence TTTCCAGACCGCTGGGTCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137495365_1137495373 21 Left 1137495365 16:48965268-48965290 CCTTGGACCCAGCGGTCTGGAAA No data
Right 1137495373 16:48965312-48965334 TCTGTGTAGACAGATGAAGGAGG No data
1137495365_1137495375 26 Left 1137495365 16:48965268-48965290 CCTTGGACCCAGCGGTCTGGAAA No data
Right 1137495375 16:48965317-48965339 GTAGACAGATGAAGGAGGGACGG No data
1137495365_1137495374 22 Left 1137495365 16:48965268-48965290 CCTTGGACCCAGCGGTCTGGAAA No data
Right 1137495374 16:48965313-48965335 CTGTGTAGACAGATGAAGGAGGG No data
1137495365_1137495377 28 Left 1137495365 16:48965268-48965290 CCTTGGACCCAGCGGTCTGGAAA No data
Right 1137495377 16:48965319-48965341 AGACAGATGAAGGAGGGACGGGG No data
1137495365_1137495372 18 Left 1137495365 16:48965268-48965290 CCTTGGACCCAGCGGTCTGGAAA No data
Right 1137495372 16:48965309-48965331 AACTCTGTGTAGACAGATGAAGG No data
1137495365_1137495376 27 Left 1137495365 16:48965268-48965290 CCTTGGACCCAGCGGTCTGGAAA No data
Right 1137495376 16:48965318-48965340 TAGACAGATGAAGGAGGGACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137495365 Original CRISPR TTTCCAGACCGCTGGGTCCA AGG (reversed) Intergenic
No off target data available for this crispr