ID: 1137495367

View in Genome Browser
Species Human (GRCh38)
Location 16:48965276-48965298
Sequence CAGGGCTGTTTCCAGACCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137495367_1137495377 20 Left 1137495367 16:48965276-48965298 CCAGCGGTCTGGAAACAGCCCTG No data
Right 1137495377 16:48965319-48965341 AGACAGATGAAGGAGGGACGGGG No data
1137495367_1137495373 13 Left 1137495367 16:48965276-48965298 CCAGCGGTCTGGAAACAGCCCTG No data
Right 1137495373 16:48965312-48965334 TCTGTGTAGACAGATGAAGGAGG No data
1137495367_1137495372 10 Left 1137495367 16:48965276-48965298 CCAGCGGTCTGGAAACAGCCCTG No data
Right 1137495372 16:48965309-48965331 AACTCTGTGTAGACAGATGAAGG No data
1137495367_1137495380 27 Left 1137495367 16:48965276-48965298 CCAGCGGTCTGGAAACAGCCCTG No data
Right 1137495380 16:48965326-48965348 TGAAGGAGGGACGGGGAGGAGGG No data
1137495367_1137495379 26 Left 1137495367 16:48965276-48965298 CCAGCGGTCTGGAAACAGCCCTG No data
Right 1137495379 16:48965325-48965347 ATGAAGGAGGGACGGGGAGGAGG No data
1137495367_1137495374 14 Left 1137495367 16:48965276-48965298 CCAGCGGTCTGGAAACAGCCCTG No data
Right 1137495374 16:48965313-48965335 CTGTGTAGACAGATGAAGGAGGG No data
1137495367_1137495376 19 Left 1137495367 16:48965276-48965298 CCAGCGGTCTGGAAACAGCCCTG No data
Right 1137495376 16:48965318-48965340 TAGACAGATGAAGGAGGGACGGG No data
1137495367_1137495378 23 Left 1137495367 16:48965276-48965298 CCAGCGGTCTGGAAACAGCCCTG No data
Right 1137495378 16:48965322-48965344 CAGATGAAGGAGGGACGGGGAGG No data
1137495367_1137495375 18 Left 1137495367 16:48965276-48965298 CCAGCGGTCTGGAAACAGCCCTG No data
Right 1137495375 16:48965317-48965339 GTAGACAGATGAAGGAGGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137495367 Original CRISPR CAGGGCTGTTTCCAGACCGC TGG (reversed) Intergenic
No off target data available for this crispr