ID: 1137495368

View in Genome Browser
Species Human (GRCh38)
Location 16:48965294-48965316
Sequence ACAGAGTTAGCGGGCTTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137495368_1137495372 -8 Left 1137495368 16:48965294-48965316 CCCTGCAAGCCCGCTAACTCTGT No data
Right 1137495372 16:48965309-48965331 AACTCTGTGTAGACAGATGAAGG No data
1137495368_1137495379 8 Left 1137495368 16:48965294-48965316 CCCTGCAAGCCCGCTAACTCTGT No data
Right 1137495379 16:48965325-48965347 ATGAAGGAGGGACGGGGAGGAGG No data
1137495368_1137495375 0 Left 1137495368 16:48965294-48965316 CCCTGCAAGCCCGCTAACTCTGT No data
Right 1137495375 16:48965317-48965339 GTAGACAGATGAAGGAGGGACGG No data
1137495368_1137495374 -4 Left 1137495368 16:48965294-48965316 CCCTGCAAGCCCGCTAACTCTGT No data
Right 1137495374 16:48965313-48965335 CTGTGTAGACAGATGAAGGAGGG No data
1137495368_1137495380 9 Left 1137495368 16:48965294-48965316 CCCTGCAAGCCCGCTAACTCTGT No data
Right 1137495380 16:48965326-48965348 TGAAGGAGGGACGGGGAGGAGGG No data
1137495368_1137495373 -5 Left 1137495368 16:48965294-48965316 CCCTGCAAGCCCGCTAACTCTGT No data
Right 1137495373 16:48965312-48965334 TCTGTGTAGACAGATGAAGGAGG No data
1137495368_1137495381 15 Left 1137495368 16:48965294-48965316 CCCTGCAAGCCCGCTAACTCTGT No data
Right 1137495381 16:48965332-48965354 AGGGACGGGGAGGAGGGACAAGG No data
1137495368_1137495382 24 Left 1137495368 16:48965294-48965316 CCCTGCAAGCCCGCTAACTCTGT No data
Right 1137495382 16:48965341-48965363 GAGGAGGGACAAGGAAGCCCAGG No data
1137495368_1137495377 2 Left 1137495368 16:48965294-48965316 CCCTGCAAGCCCGCTAACTCTGT No data
Right 1137495377 16:48965319-48965341 AGACAGATGAAGGAGGGACGGGG No data
1137495368_1137495378 5 Left 1137495368 16:48965294-48965316 CCCTGCAAGCCCGCTAACTCTGT No data
Right 1137495378 16:48965322-48965344 CAGATGAAGGAGGGACGGGGAGG No data
1137495368_1137495376 1 Left 1137495368 16:48965294-48965316 CCCTGCAAGCCCGCTAACTCTGT No data
Right 1137495376 16:48965318-48965340 TAGACAGATGAAGGAGGGACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137495368 Original CRISPR ACAGAGTTAGCGGGCTTGCA GGG (reversed) Intergenic
No off target data available for this crispr