ID: 1137495374

View in Genome Browser
Species Human (GRCh38)
Location 16:48965313-48965335
Sequence CTGTGTAGACAGATGAAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137495367_1137495374 14 Left 1137495367 16:48965276-48965298 CCAGCGGTCTGGAAACAGCCCTG No data
Right 1137495374 16:48965313-48965335 CTGTGTAGACAGATGAAGGAGGG No data
1137495362_1137495374 29 Left 1137495362 16:48965261-48965283 CCCATTGCCTTGGACCCAGCGGT No data
Right 1137495374 16:48965313-48965335 CTGTGTAGACAGATGAAGGAGGG No data
1137495369_1137495374 -5 Left 1137495369 16:48965295-48965317 CCTGCAAGCCCGCTAACTCTGTG No data
Right 1137495374 16:48965313-48965335 CTGTGTAGACAGATGAAGGAGGG No data
1137495368_1137495374 -4 Left 1137495368 16:48965294-48965316 CCCTGCAAGCCCGCTAACTCTGT No data
Right 1137495374 16:48965313-48965335 CTGTGTAGACAGATGAAGGAGGG No data
1137495366_1137495374 15 Left 1137495366 16:48965275-48965297 CCCAGCGGTCTGGAAACAGCCCT No data
Right 1137495374 16:48965313-48965335 CTGTGTAGACAGATGAAGGAGGG No data
1137495365_1137495374 22 Left 1137495365 16:48965268-48965290 CCTTGGACCCAGCGGTCTGGAAA No data
Right 1137495374 16:48965313-48965335 CTGTGTAGACAGATGAAGGAGGG No data
1137495360_1137495374 30 Left 1137495360 16:48965260-48965282 CCCCATTGCCTTGGACCCAGCGG No data
Right 1137495374 16:48965313-48965335 CTGTGTAGACAGATGAAGGAGGG No data
1137495363_1137495374 28 Left 1137495363 16:48965262-48965284 CCATTGCCTTGGACCCAGCGGTC No data
Right 1137495374 16:48965313-48965335 CTGTGTAGACAGATGAAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137495374 Original CRISPR CTGTGTAGACAGATGAAGGA GGG Intergenic
No off target data available for this crispr