ID: 1137496267

View in Genome Browser
Species Human (GRCh38)
Location 16:48971598-48971620
Sequence GACACTGCTGTGATCAGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137496267_1137496272 -6 Left 1137496267 16:48971598-48971620 CCAGCCCTGATCACAGCAGTGTC No data
Right 1137496272 16:48971615-48971637 AGTGTCTGTGCTGTCCCCTGGGG No data
1137496267_1137496271 -7 Left 1137496267 16:48971598-48971620 CCAGCCCTGATCACAGCAGTGTC No data
Right 1137496271 16:48971614-48971636 CAGTGTCTGTGCTGTCCCCTGGG No data
1137496267_1137496270 -8 Left 1137496267 16:48971598-48971620 CCAGCCCTGATCACAGCAGTGTC No data
Right 1137496270 16:48971613-48971635 GCAGTGTCTGTGCTGTCCCCTGG No data
1137496267_1137496273 -5 Left 1137496267 16:48971598-48971620 CCAGCCCTGATCACAGCAGTGTC No data
Right 1137496273 16:48971616-48971638 GTGTCTGTGCTGTCCCCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137496267 Original CRISPR GACACTGCTGTGATCAGGGC TGG (reversed) Intergenic
No off target data available for this crispr