ID: 1137497226

View in Genome Browser
Species Human (GRCh38)
Location 16:48979891-48979913
Sequence CTGAAGAACAAGATTGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137497223_1137497226 4 Left 1137497223 16:48979864-48979886 CCTGTTCAAGCTGGACAGTGAAG No data
Right 1137497226 16:48979891-48979913 CTGAAGAACAAGATTGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137497226 Original CRISPR CTGAAGAACAAGATTGAGCA GGG Intergenic
No off target data available for this crispr