ID: 1137500779

View in Genome Browser
Species Human (GRCh38)
Location 16:49010383-49010405
Sequence AATGAACCCCACCAAGGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137500779_1137500786 2 Left 1137500779 16:49010383-49010405 CCTGGCCCTTGGTGGGGTTCATT No data
Right 1137500786 16:49010408-49010430 CTGAGTTCCGGGAATCCTGCAGG No data
1137500779_1137500782 -10 Left 1137500779 16:49010383-49010405 CCTGGCCCTTGGTGGGGTTCATT No data
Right 1137500782 16:49010396-49010418 GGGGTTCATTCCCTGAGTTCCGG No data
1137500779_1137500789 20 Left 1137500779 16:49010383-49010405 CCTGGCCCTTGGTGGGGTTCATT No data
Right 1137500789 16:49010426-49010448 GCAGGAATCTCTATGAAGAGTGG No data
1137500779_1137500783 -9 Left 1137500779 16:49010383-49010405 CCTGGCCCTTGGTGGGGTTCATT No data
Right 1137500783 16:49010397-49010419 GGGTTCATTCCCTGAGTTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137500779 Original CRISPR AATGAACCCCACCAAGGGCC AGG (reversed) Intergenic
No off target data available for this crispr