ID: 1137501127

View in Genome Browser
Species Human (GRCh38)
Location 16:49012612-49012634
Sequence ATGTCTTTAAGGAGAGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137501127_1137501131 21 Left 1137501127 16:49012612-49012634 CCTGCTTCTCTCCTTAAAGACAT No data
Right 1137501131 16:49012656-49012678 AAGCACCCTGCAGTTTTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137501127 Original CRISPR ATGTCTTTAAGGAGAGAAGC AGG (reversed) Intergenic
No off target data available for this crispr