ID: 1137501507

View in Genome Browser
Species Human (GRCh38)
Location 16:49014985-49015007
Sequence CAGTGTGGCCGGAGCAGAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137501498_1137501507 22 Left 1137501498 16:49014940-49014962 CCGGGCCAAGACATGCTGGGAGT No data
Right 1137501507 16:49014985-49015007 CAGTGTGGCCGGAGCAGAGTGGG No data
1137501503_1137501507 -3 Left 1137501503 16:49014965-49014987 CCAGGGAACATCTCTAAGTTCAG No data
Right 1137501507 16:49014985-49015007 CAGTGTGGCCGGAGCAGAGTGGG No data
1137501502_1137501507 -2 Left 1137501502 16:49014964-49014986 CCCAGGGAACATCTCTAAGTTCA No data
Right 1137501507 16:49014985-49015007 CAGTGTGGCCGGAGCAGAGTGGG No data
1137501496_1137501507 24 Left 1137501496 16:49014938-49014960 CCCCGGGCCAAGACATGCTGGGA No data
Right 1137501507 16:49014985-49015007 CAGTGTGGCCGGAGCAGAGTGGG No data
1137501497_1137501507 23 Left 1137501497 16:49014939-49014961 CCCGGGCCAAGACATGCTGGGAG No data
Right 1137501507 16:49014985-49015007 CAGTGTGGCCGGAGCAGAGTGGG No data
1137501499_1137501507 17 Left 1137501499 16:49014945-49014967 CCAAGACATGCTGGGAGTGCCCA No data
Right 1137501507 16:49014985-49015007 CAGTGTGGCCGGAGCAGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137501507 Original CRISPR CAGTGTGGCCGGAGCAGAGT GGG Intergenic
No off target data available for this crispr