ID: 1137502207

View in Genome Browser
Species Human (GRCh38)
Location 16:49020064-49020086
Sequence ATATACACAGGGCCGGGCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137502197_1137502207 7 Left 1137502197 16:49020034-49020056 CCGCCCCGCCTTCCACGTGTGCA No data
Right 1137502207 16:49020064-49020086 ATATACACAGGGCCGGGCCAAGG No data
1137502201_1137502207 -1 Left 1137502201 16:49020042-49020064 CCTTCCACGTGTGCACACACTTA No data
Right 1137502207 16:49020064-49020086 ATATACACAGGGCCGGGCCAAGG No data
1137502200_1137502207 2 Left 1137502200 16:49020039-49020061 CCGCCTTCCACGTGTGCACACAC No data
Right 1137502207 16:49020064-49020086 ATATACACAGGGCCGGGCCAAGG No data
1137502202_1137502207 -5 Left 1137502202 16:49020046-49020068 CCACGTGTGCACACACTTATATA No data
Right 1137502207 16:49020064-49020086 ATATACACAGGGCCGGGCCAAGG No data
1137502198_1137502207 4 Left 1137502198 16:49020037-49020059 CCCCGCCTTCCACGTGTGCACAC No data
Right 1137502207 16:49020064-49020086 ATATACACAGGGCCGGGCCAAGG No data
1137502196_1137502207 11 Left 1137502196 16:49020030-49020052 CCTGCCGCCCCGCCTTCCACGTG No data
Right 1137502207 16:49020064-49020086 ATATACACAGGGCCGGGCCAAGG No data
1137502199_1137502207 3 Left 1137502199 16:49020038-49020060 CCCGCCTTCCACGTGTGCACACA No data
Right 1137502207 16:49020064-49020086 ATATACACAGGGCCGGGCCAAGG No data
1137502195_1137502207 28 Left 1137502195 16:49020013-49020035 CCACACAGGGCTGCTAGCCTGCC No data
Right 1137502207 16:49020064-49020086 ATATACACAGGGCCGGGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137502207 Original CRISPR ATATACACAGGGCCGGGCCA AGG Intergenic
No off target data available for this crispr