ID: 1137507156

View in Genome Browser
Species Human (GRCh38)
Location 16:49064154-49064176
Sequence GGGGACAATAAGAAGAATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137507156_1137507162 14 Left 1137507156 16:49064154-49064176 CCTGCATTCTTCTTATTGTCCCC No data
Right 1137507162 16:49064191-49064213 AGCTATGGACTGCACAGAGTAGG No data
1137507156_1137507161 -1 Left 1137507156 16:49064154-49064176 CCTGCATTCTTCTTATTGTCCCC No data
Right 1137507161 16:49064176-49064198 CAGTGGACACTGAGCAGCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137507156 Original CRISPR GGGGACAATAAGAAGAATGC AGG (reversed) Intergenic
No off target data available for this crispr