ID: 1137507161

View in Genome Browser
Species Human (GRCh38)
Location 16:49064176-49064198
Sequence CAGTGGACACTGAGCAGCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137507153_1137507161 22 Left 1137507153 16:49064131-49064153 CCTGAGCCACATGGGTTGATGTC No data
Right 1137507161 16:49064176-49064198 CAGTGGACACTGAGCAGCTATGG No data
1137507156_1137507161 -1 Left 1137507156 16:49064154-49064176 CCTGCATTCTTCTTATTGTCCCC No data
Right 1137507161 16:49064176-49064198 CAGTGGACACTGAGCAGCTATGG No data
1137507155_1137507161 0 Left 1137507155 16:49064153-49064175 CCCTGCATTCTTCTTATTGTCCC No data
Right 1137507161 16:49064176-49064198 CAGTGGACACTGAGCAGCTATGG No data
1137507154_1137507161 16 Left 1137507154 16:49064137-49064159 CCACATGGGTTGATGTCCCTGCA No data
Right 1137507161 16:49064176-49064198 CAGTGGACACTGAGCAGCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137507161 Original CRISPR CAGTGGACACTGAGCAGCTA TGG Intergenic
No off target data available for this crispr