ID: 1137507162

View in Genome Browser
Species Human (GRCh38)
Location 16:49064191-49064213
Sequence AGCTATGGACTGCACAGAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137507159_1137507162 -6 Left 1137507159 16:49064174-49064196 CCCAGTGGACACTGAGCAGCTAT No data
Right 1137507162 16:49064191-49064213 AGCTATGGACTGCACAGAGTAGG No data
1137507158_1137507162 -5 Left 1137507158 16:49064173-49064195 CCCCAGTGGACACTGAGCAGCTA No data
Right 1137507162 16:49064191-49064213 AGCTATGGACTGCACAGAGTAGG No data
1137507160_1137507162 -7 Left 1137507160 16:49064175-49064197 CCAGTGGACACTGAGCAGCTATG No data
Right 1137507162 16:49064191-49064213 AGCTATGGACTGCACAGAGTAGG No data
1137507156_1137507162 14 Left 1137507156 16:49064154-49064176 CCTGCATTCTTCTTATTGTCCCC No data
Right 1137507162 16:49064191-49064213 AGCTATGGACTGCACAGAGTAGG No data
1137507155_1137507162 15 Left 1137507155 16:49064153-49064175 CCCTGCATTCTTCTTATTGTCCC No data
Right 1137507162 16:49064191-49064213 AGCTATGGACTGCACAGAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137507162 Original CRISPR AGCTATGGACTGCACAGAGT AGG Intergenic
No off target data available for this crispr