ID: 1137507623

View in Genome Browser
Species Human (GRCh38)
Location 16:49068249-49068271
Sequence CCTGTGAGAGATGGATTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137507623_1137507632 -8 Left 1137507623 16:49068249-49068271 CCCTCAAATCCATCTCTCACAGG No data
Right 1137507632 16:49068264-49068286 CTCACAGGATTCTGGGCTGGGGG No data
1137507623_1137507633 1 Left 1137507623 16:49068249-49068271 CCCTCAAATCCATCTCTCACAGG No data
Right 1137507633 16:49068273-49068295 TTCTGGGCTGGGGGTTTTTAAGG No data
1137507623_1137507637 10 Left 1137507623 16:49068249-49068271 CCCTCAAATCCATCTCTCACAGG No data
Right 1137507637 16:49068282-49068304 GGGGGTTTTTAAGGGGATGGTGG No data
1137507623_1137507631 -9 Left 1137507623 16:49068249-49068271 CCCTCAAATCCATCTCTCACAGG No data
Right 1137507631 16:49068263-49068285 TCTCACAGGATTCTGGGCTGGGG No data
1137507623_1137507639 14 Left 1137507623 16:49068249-49068271 CCCTCAAATCCATCTCTCACAGG No data
Right 1137507639 16:49068286-49068308 GTTTTTAAGGGGATGGTGGAGGG No data
1137507623_1137507630 -10 Left 1137507623 16:49068249-49068271 CCCTCAAATCCATCTCTCACAGG No data
Right 1137507630 16:49068262-49068284 CTCTCACAGGATTCTGGGCTGGG No data
1137507623_1137507641 21 Left 1137507623 16:49068249-49068271 CCCTCAAATCCATCTCTCACAGG No data
Right 1137507641 16:49068293-49068315 AGGGGATGGTGGAGGGTGAAGGG No data
1137507623_1137507638 13 Left 1137507623 16:49068249-49068271 CCCTCAAATCCATCTCTCACAGG No data
Right 1137507638 16:49068285-49068307 GGTTTTTAAGGGGATGGTGGAGG No data
1137507623_1137507635 3 Left 1137507623 16:49068249-49068271 CCCTCAAATCCATCTCTCACAGG No data
Right 1137507635 16:49068275-49068297 CTGGGCTGGGGGTTTTTAAGGGG No data
1137507623_1137507636 7 Left 1137507623 16:49068249-49068271 CCCTCAAATCCATCTCTCACAGG No data
Right 1137507636 16:49068279-49068301 GCTGGGGGTTTTTAAGGGGATGG No data
1137507623_1137507642 22 Left 1137507623 16:49068249-49068271 CCCTCAAATCCATCTCTCACAGG No data
Right 1137507642 16:49068294-49068316 GGGGATGGTGGAGGGTGAAGGGG No data
1137507623_1137507640 20 Left 1137507623 16:49068249-49068271 CCCTCAAATCCATCTCTCACAGG No data
Right 1137507640 16:49068292-49068314 AAGGGGATGGTGGAGGGTGAAGG No data
1137507623_1137507634 2 Left 1137507623 16:49068249-49068271 CCCTCAAATCCATCTCTCACAGG No data
Right 1137507634 16:49068274-49068296 TCTGGGCTGGGGGTTTTTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137507623 Original CRISPR CCTGTGAGAGATGGATTTGA GGG (reversed) Intergenic
No off target data available for this crispr