ID: 1137507639

View in Genome Browser
Species Human (GRCh38)
Location 16:49068286-49068308
Sequence GTTTTTAAGGGGATGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137507625_1137507639 13 Left 1137507625 16:49068250-49068272 CCTCAAATCCATCTCTCACAGGA No data
Right 1137507639 16:49068286-49068308 GTTTTTAAGGGGATGGTGGAGGG No data
1137507623_1137507639 14 Left 1137507623 16:49068249-49068271 CCCTCAAATCCATCTCTCACAGG No data
Right 1137507639 16:49068286-49068308 GTTTTTAAGGGGATGGTGGAGGG No data
1137507628_1137507639 5 Left 1137507628 16:49068258-49068280 CCATCTCTCACAGGATTCTGGGC No data
Right 1137507639 16:49068286-49068308 GTTTTTAAGGGGATGGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137507639 Original CRISPR GTTTTTAAGGGGATGGTGGA GGG Intergenic
No off target data available for this crispr