ID: 1137510796

View in Genome Browser
Species Human (GRCh38)
Location 16:49098351-49098373
Sequence CAGGATAAACATACAAATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137510796_1137510801 17 Left 1137510796 16:49098351-49098373 CCTGCATTTGTATGTTTATCCTG No data
Right 1137510801 16:49098391-49098413 AAGACATGGAATCAACCCAGGGG No data
1137510796_1137510799 15 Left 1137510796 16:49098351-49098373 CCTGCATTTGTATGTTTATCCTG No data
Right 1137510799 16:49098389-49098411 CAAAGACATGGAATCAACCCAGG 0: 130
1: 770
2: 1150
3: 1134
4: 1062
1137510796_1137510800 16 Left 1137510796 16:49098351-49098373 CCTGCATTTGTATGTTTATCCTG No data
Right 1137510800 16:49098390-49098412 AAAGACATGGAATCAACCCAGGG No data
1137510796_1137510798 3 Left 1137510796 16:49098351-49098373 CCTGCATTTGTATGTTTATCCTG No data
Right 1137510798 16:49098377-49098399 TACTCACAATATCAAAGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137510796 Original CRISPR CAGGATAAACATACAAATGC AGG (reversed) Intergenic
No off target data available for this crispr