ID: 1137512326

View in Genome Browser
Species Human (GRCh38)
Location 16:49112454-49112476
Sequence TGCCCTGACCTGCCTCAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137512326_1137512328 -4 Left 1137512326 16:49112454-49112476 CCACTCTGAGGCAGGTCAGGGCA No data
Right 1137512328 16:49112473-49112495 GGCAGAGCACTGAGGTTGTGCGG No data
1137512326_1137512329 16 Left 1137512326 16:49112454-49112476 CCACTCTGAGGCAGGTCAGGGCA No data
Right 1137512329 16:49112493-49112515 CGGTTGAATGCAACTGACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137512326 Original CRISPR TGCCCTGACCTGCCTCAGAG TGG (reversed) Intergenic
No off target data available for this crispr