ID: 1137518279

View in Genome Browser
Species Human (GRCh38)
Location 16:49169522-49169544
Sequence GAGGACATCGAAAATGATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137518270_1137518279 15 Left 1137518270 16:49169484-49169506 CCTTTAAAAGACATAAAGAAGCT No data
Right 1137518279 16:49169522-49169544 GAGGACATCGAAAATGATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137518279 Original CRISPR GAGGACATCGAAAATGATCA AGG Intergenic
No off target data available for this crispr