ID: 1137524359

View in Genome Browser
Species Human (GRCh38)
Location 16:49221302-49221324
Sequence GCTTCTGAGGCTAATCTCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137524359_1137524363 -6 Left 1137524359 16:49221302-49221324 CCATTGAGATTAGCCTCAGAAGC No data
Right 1137524363 16:49221319-49221341 AGAAGCTTCTTGGAGAAGGCAGG No data
1137524359_1137524366 29 Left 1137524359 16:49221302-49221324 CCATTGAGATTAGCCTCAGAAGC No data
Right 1137524366 16:49221354-49221376 ATGAGTAGCTGGGTTTGACCAGG No data
1137524359_1137524365 19 Left 1137524359 16:49221302-49221324 CCATTGAGATTAGCCTCAGAAGC No data
Right 1137524365 16:49221344-49221366 TTAAGTGACAATGAGTAGCTGGG No data
1137524359_1137524364 18 Left 1137524359 16:49221302-49221324 CCATTGAGATTAGCCTCAGAAGC No data
Right 1137524364 16:49221343-49221365 TTTAAGTGACAATGAGTAGCTGG No data
1137524359_1137524362 -10 Left 1137524359 16:49221302-49221324 CCATTGAGATTAGCCTCAGAAGC No data
Right 1137524362 16:49221315-49221337 CCTCAGAAGCTTCTTGGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137524359 Original CRISPR GCTTCTGAGGCTAATCTCAA TGG (reversed) Intergenic
No off target data available for this crispr