ID: 1137525988

View in Genome Browser
Species Human (GRCh38)
Location 16:49236756-49236778
Sequence CCGGCTATGAAGATGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137525982_1137525988 30 Left 1137525982 16:49236703-49236725 CCAGCTGGCTCAAAGGGTGATAT No data
Right 1137525988 16:49236756-49236778 CCGGCTATGAAGATGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137525988 Original CRISPR CCGGCTATGAAGATGGAGGA GGG Intergenic
No off target data available for this crispr