ID: 1137527573

View in Genome Browser
Species Human (GRCh38)
Location 16:49249771-49249793
Sequence TCTTACTTGCAGATTCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137527573_1137527575 -8 Left 1137527573 16:49249771-49249793 CCTTCCAGAATCTGCAAGTAAGA No data
Right 1137527575 16:49249786-49249808 AAGTAAGAATAACACCTTCTTGG No data
1137527573_1137527577 17 Left 1137527573 16:49249771-49249793 CCTTCCAGAATCTGCAAGTAAGA No data
Right 1137527577 16:49249811-49249833 CAATGAGAAGAACAACAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137527573 Original CRISPR TCTTACTTGCAGATTCTGGA AGG (reversed) Intergenic
No off target data available for this crispr