ID: 1137528540

View in Genome Browser
Species Human (GRCh38)
Location 16:49261026-49261048
Sequence GTCCCACGGGATCTCGGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137528540_1137528548 -1 Left 1137528540 16:49261026-49261048 CCTCCCCCGAGATCCCGTGGGAC No data
Right 1137528548 16:49261048-49261070 CTTGGCACCTCTGTCTACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137528540 Original CRISPR GTCCCACGGGATCTCGGGGG AGG (reversed) Intergenic
No off target data available for this crispr