ID: 1137529969

View in Genome Browser
Species Human (GRCh38)
Location 16:49273109-49273131
Sequence CTGCGTGAACAGATGGATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137529969_1137529972 7 Left 1137529969 16:49273109-49273131 CCTCCATCCATCTGTTCACGCAG No data
Right 1137529972 16:49273139-49273161 CTCACTTTCTCACGCATTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137529969 Original CRISPR CTGCGTGAACAGATGGATGG AGG (reversed) Intergenic
No off target data available for this crispr