ID: 1137531407

View in Genome Browser
Species Human (GRCh38)
Location 16:49281098-49281120
Sequence AAGGGCTCTGCGGAGGCGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 141}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137531407_1137531415 -10 Left 1137531407 16:49281098-49281120 CCCCGCGCCTCCGCAGAGCCCTT 0: 1
1: 0
2: 0
3: 9
4: 141
Right 1137531415 16:49281111-49281133 CAGAGCCCTTGGAGAGGACCGGG 0: 1
1: 0
2: 1
3: 26
4: 328
1137531407_1137531418 -4 Left 1137531407 16:49281098-49281120 CCCCGCGCCTCCGCAGAGCCCTT 0: 1
1: 0
2: 0
3: 9
4: 141
Right 1137531418 16:49281117-49281139 CCTTGGAGAGGACCGGGCATCGG 0: 1
1: 0
2: 0
3: 14
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137531407 Original CRISPR AAGGGCTCTGCGGAGGCGCG GGG (reversed) Intronic
901130687 1:6961298-6961320 AAGGGCTTTGGGGAGGCCAGAGG + Intronic
901301045 1:8200363-8200385 AAGGGCTCTGTGGTGGAGAGAGG + Intergenic
901506618 1:9689538-9689560 CGGGGCTCGGCGGAGGGGCGCGG - Intronic
903349848 1:22710982-22711004 CATGGCTCTGCGGAGGCTGGGGG + Exonic
905847058 1:41242061-41242083 GAGGGCGCGGCGGGGGCGCGGGG + Intronic
906087021 1:43144771-43144793 AAGGGCTAGGAGGAGGAGCGGGG - Intergenic
919464901 1:197915412-197915434 AAGGGCCCTGAGGAGGGGCTGGG - Intronic
920307902 1:205030817-205030839 GAGGGCTCTGAGGAGGGGCTGGG - Intergenic
921122334 1:212147935-212147957 AAGGGAACTGCGGTGGGGCGGGG - Intergenic
921835391 1:219772820-219772842 AAGGGCTATGGGGAGGGGCAAGG + Intronic
921850609 1:219928770-219928792 AGGGGCGCTGCGGAGGAGAGGGG + Intronic
922886919 1:229027467-229027489 AAAGGCTGTGGGGAGGTGCGAGG - Intergenic
1064410018 10:15097086-15097108 AGGGGCAGTGCGCAGGCGCGAGG - Exonic
1065140393 10:22714158-22714180 AAGGGCTCAGCTGCGGCGCGCGG - Intronic
1067051632 10:43024886-43024908 AAGGGCTCTGGGCAGGCTCCCGG - Intergenic
1067060692 10:43076730-43076752 AGCGGCTCTGCGTAGGTGCGCGG + Intergenic
1067561951 10:47310407-47310429 AAGTGCTGTGCGTGGGCGCGCGG - Exonic
1069926055 10:71851433-71851455 AAGGGCTATGGGGAGGAGTGAGG + Intergenic
1070458720 10:76643619-76643641 AAGGGCTGTGCTGAGGCGCCGGG - Intergenic
1070942189 10:80357329-80357351 AAGGCGTATGTGGAGGCGCGCGG + Intronic
1072682513 10:97517227-97517249 AGGGGCTCTGGGGAGGGGCCTGG + Intronic
1074109575 10:110412955-110412977 AAGGCCTCTAGGGAGGCCCGAGG - Intergenic
1075698108 10:124450251-124450273 GAGGGTTGGGCGGAGGCGCGCGG - Intergenic
1077250487 11:1558652-1558674 CAGGGCTCGGGGGAGGAGCGGGG - Intronic
1077553341 11:3213966-3213988 AAGGGCTGTGACGAGGGGCGTGG - Intergenic
1077553347 11:3213994-3214016 AAGGGCTGTGACGAGGGGCGTGG - Intergenic
1078454896 11:11467357-11467379 AAGGGCTCTGTGAAGGGGCAGGG - Intronic
1081872961 11:46391593-46391615 AGTGGCTCCGCGGCGGCGCGGGG - Intergenic
1084680333 11:70662978-70663000 AAGGCCTCTGTGGAGGGGAGCGG + Intronic
1084888222 11:72224110-72224132 AAGGGCTCTGCGGGGCTGGGAGG + Intronic
1090131031 11:124142212-124142234 CAGGGCTCTGCTGGGGGGCGAGG - Intronic
1091778713 12:3200690-3200712 GAGGGCTCTGCGGCGCGGCGCGG - Intronic
1092894693 12:13000609-13000631 AAGGGGTCTGCGGAGGGGGACGG - Intergenic
1096789580 12:54036383-54036405 AGGGGCTCTGGGGAGGGGCAGGG + Intronic
1103899224 12:124294979-124295001 AGGGCCTCGGCGGAGGCGCCGGG + Intronic
1104393162 12:128408422-128408444 AAGGGCTCTGTGAAGGGGCGGGG - Intronic
1104914859 12:132259466-132259488 AAGCGCCCTGCGGAGGAGCGAGG + Intronic
1106333570 13:28762812-28762834 CAGGTCTCTGAGGAGGAGCGGGG + Intergenic
1107087336 13:36439889-36439911 AAGGGCCATGCGGAGAGGCGTGG + Intronic
1110893337 13:80717067-80717089 AAGGGCTCTCCCAAGGCGGGAGG - Intergenic
1113372297 13:109734356-109734378 CAGGGCTCTGCTGTGGGGCGGGG + Intergenic
1114655202 14:24311589-24311611 GAAGGCTCTGGGGAGGCCCGAGG + Exonic
1115235703 14:31207322-31207344 AAGGGCCCTGCGTGGGGGCGCGG - Exonic
1122951031 14:105045042-105045064 AGGGGCTCTGCGGAGTCGATGGG + Intergenic
1124180108 15:27465179-27465201 ATGGGCTCTGCTGAGGCAAGTGG - Intronic
1128119244 15:65133570-65133592 GAGGCCTCCGCGGAGGCTCGGGG + Exonic
1128874973 15:71194414-71194436 AAGGGCACTGCGGAGGGGTCTGG + Intronic
1130348110 15:83067264-83067286 GAGGGGCCTGCGGAGGCGCGAGG - Exonic
1131052679 15:89359031-89359053 GAGGGCTCGGCGGAGGCGCCAGG + Intergenic
1132675265 16:1118763-1118785 AAGGGCAGTGAGGAGGCGAGAGG + Intergenic
1132889517 16:2196836-2196858 CAGGCCTCTGCGGACGCGGGCGG + Intergenic
1134517075 16:14895810-14895832 AGGGGCTCTACGGAGGGGTGAGG - Exonic
1134704745 16:16294464-16294486 AGGGGCTCTACGGAGGGGTGAGG - Exonic
1134962797 16:18417650-18417672 AGGGGCTCTACGGAGGGGTGAGG + Intronic
1134967092 16:18500249-18500271 AGGGGCTCTACGGAGGGGTGAGG + Intronic
1137531407 16:49281098-49281120 AAGGGCTCTGCGGAGGCGCGGGG - Intronic
1139589952 16:67928055-67928077 AAGGGCTCTGTGGAGGAAAGGGG - Exonic
1142345051 16:89548550-89548572 AGGGGCTCTGCGGAGAGGTGTGG + Intronic
1142356765 16:89605041-89605063 GAAGGCTCTGCGGAGGCCCCAGG + Intergenic
1146339675 17:32007864-32007886 ACGGGCCCGGCGGGGGCGCGGGG + Intronic
1146912889 17:36659549-36659571 AAGGGGTCTGCCGAGGCCTGGGG + Intergenic
1147652164 17:42068884-42068906 AAGGGCTCTGGGGAGGGGCAGGG + Intergenic
1152403364 17:80082767-80082789 AGGGGCTCGGCGGGGGCCCGGGG - Intronic
1154291783 18:13115200-13115222 AAGGGAGCTGTGGAGGCGCGGGG - Intronic
1156485520 18:37463324-37463346 AAGGGCTCTGGGGAGTTGCCTGG - Intronic
1159574362 18:70157175-70157197 AAGTGCTCTGGGGGGGCGTGGGG - Intronic
1160433842 18:78831153-78831175 AAGGGCTCTGCACAGCCCCGTGG + Intergenic
1160553568 18:79711794-79711816 AAAGTCTTTGCGGAGGGGCGGGG - Intronic
1160969535 19:1761440-1761462 TAGGGCTCTGGGGAGCCACGGGG - Intronic
1161311307 19:3595644-3595666 AAGGGCTCCGCGGAAAGGCGCGG + Intronic
1161772581 19:6239107-6239129 CAGGGCTCTGTGGACGCGAGAGG - Intronic
1162070389 19:8149224-8149246 AGGGGCTCGGCCGGGGCGCGGGG - Intronic
1167609914 19:50502040-50502062 GAGGGCTCTGCAGAGGCTGGCGG - Intergenic
1168252630 19:55149135-55149157 AGGGGCTCTGCGGAGCCCTGTGG - Intronic
1168406825 19:56114837-56114859 GAGGGCTCTGCGGCGGGGCCGGG - Intronic
927513295 2:23657953-23657975 ATGGGCTTTGCGGAGCCACGGGG + Intronic
927868128 2:26606029-26606051 AAGGGCAGGGGGGAGGCGCGGGG + Intronic
933651780 2:84855661-84855683 AAGGGCTGTGGGGAGGCAAGGGG - Intronic
933776424 2:85773888-85773910 AAGGGCTCAGCGCAGGCCCACGG + Intronic
937324829 2:120984363-120984385 CTGGGCTCTGCTGAGGGGCGTGG + Intronic
1174563682 20:51449176-51449198 AAGGGCTCTGCGGGGCGGGGCGG - Intronic
1175256868 20:57652913-57652935 AAGGGCACTGCAGAGGAGGGCGG + Intronic
1175911442 20:62407156-62407178 GCAGGCGCTGCGGAGGCGCGGGG - Exonic
1175937941 20:62523533-62523555 GAGGGCTCTGGGGAGGGCCGGGG - Intergenic
1178111764 21:29376342-29376364 CAGGGCTCTGCAGAGGTGGGAGG - Intronic
1180094780 21:45550918-45550940 AAGGGTTGTGGGGAGGCGGGGGG - Intergenic
1180783417 22:18534356-18534378 AGGGGCTCTCCAGAGGTGCGAGG - Intergenic
1180790702 22:18574088-18574110 GAGGGCTCTGAGGAGGGGCTGGG - Intergenic
1180835053 22:18925632-18925654 AAGGGGTGTGCGGAGTCGGGAGG + Intronic
1181126983 22:20708405-20708427 AGGGGCTCTCCAGAGGTGCGAGG - Intronic
1181231035 22:21421226-21421248 GAGGGCTCTGAGGAGGGGCTGGG + Intronic
1181240317 22:21473708-21473730 AGGGGCTCTCCAGAGGTGCGAGG - Intergenic
1181247613 22:21513642-21513664 GAGGGCTCTGAGGAGGGGCTGGG - Intergenic
1181543075 22:23584254-23584276 GAGGGCTCTGCAGAGGCACCAGG - Intergenic
1183966941 22:41447647-41447669 TCTGGCTCTGCGCAGGCGCGCGG + Intergenic
1183977824 22:41523457-41523479 AAGGGCCCTGCAGAGGCACTGGG + Intronic
1203285142 22_KI270734v1_random:150931-150953 AAGGGGTGTGCGGAGTCGGGAGG + Intergenic
950718142 3:14864123-14864145 TAGGGCTCTGTGTAGGCGCTGGG - Exonic
952241347 3:31533400-31533422 CGGGGCTCCGCGGCGGCGCGGGG - Intronic
955348825 3:58179695-58179717 CAGGGCTCTGGGGTGGCGCACGG - Intergenic
960628263 3:119702688-119702710 AAGGGCTGGGGGGAGGGGCGGGG + Intergenic
961222608 3:125212432-125212454 AGGGGCTCCGCGGAGGAGCCAGG - Intronic
964524788 3:157606805-157606827 AAGAGCACTGCGGAGGGGCTCGG + Intronic
967945673 3:194802011-194802033 CGGGGCTCTGTGGAGGCGCCAGG + Intergenic
967984906 3:195087310-195087332 AAGGGATCTGAGGAGGAGCCAGG - Intronic
968523783 4:1046209-1046231 AAGGGCTCTGGGAGGGCTCGGGG - Intergenic
968523801 4:1046256-1046278 AAGGGCTCTGGGAAGGCTTGGGG - Intergenic
968661798 4:1801746-1801768 GAGGGCCCTGGGGCGGCGCGGGG + Intronic
968742612 4:2339179-2339201 AAGGGCTTTGGAGAGGCCCGAGG - Intronic
969135404 4:5025077-5025099 GAGGTCTCTGCAGAGGCGCCTGG - Intergenic
977809849 4:101346556-101346578 AAGGGCGCCGCGGGGGCGGGGGG + Intronic
978384834 4:108168583-108168605 GAGGGCACTGCGGAGTCTCGGGG + Intronic
985366192 4:189235493-189235515 TAGTGCTCTGCGGTGGCGAGTGG + Intergenic
987385712 5:17327295-17327317 AAGGTGTCAGCGGAGGCGGGGGG + Intergenic
991054384 5:62306133-62306155 GCGCGCTCTGCGCAGGCGCGCGG + Intergenic
993904086 5:93604200-93604222 AAGGGCTCCGCGGGGGCACGGGG + Intergenic
998039554 5:138943819-138943841 AAGGCCTCTGAGGAGGGGCCAGG - Intergenic
998337632 5:141387672-141387694 AAGCGCGCTGCGGCTGCGCGAGG - Intronic
998338739 5:141397918-141397940 AAGCGCGCTGCGGCTGCGCGAGG - Intronic
1002190077 5:177473379-177473401 AAAGGCGCGGCGGCGGCGCGGGG + Intronic
1002520659 5:179791890-179791912 TAGGGCTCTGTGGAGGCTCAGGG + Intronic
1002565645 5:180111687-180111709 TAGGGCTCTGAGGAGGAGCAGGG + Intronic
1010204402 6:73309770-73309792 GCGGGCTCTGCGGTGGCGGGAGG - Exonic
1013663422 6:112322429-112322451 AAGGACTCTGTGAAGGCTCGAGG - Intergenic
1018413447 6:163579707-163579729 AAGGGCTCGGCCAAGGCGGGTGG + Intergenic
1018813754 6:167316427-167316449 AAGGGGTCTGGGGAGGGGTGGGG - Intergenic
1019626615 7:2019139-2019161 GAGGACTCTGGGGAGGCGGGTGG - Intronic
1030121296 7:106112638-106112660 CAGGGCTCTTCGCAGTCGCGCGG - Intergenic
1032076388 7:128838146-128838168 TGGGGCTCTGGGCAGGCGCGAGG - Intronic
1033683801 7:143620965-143620987 ACAGGCTCTGCAGTGGCGCGCGG - Exonic
1035043206 7:155945893-155945915 AAGGTCCCTGCGGAGGCTCCTGG - Intergenic
1035745519 8:1959896-1959918 CAGGGCTCTGCAGAGGAGAGGGG - Intergenic
1038532545 8:28330234-28330256 AATGGCTATGCGGAGGGGCACGG - Intronic
1040861933 8:52008179-52008201 AAGGGCCCTGGGGATGCGCATGG + Intergenic
1042155731 8:65842142-65842164 CTGGGCGCTGCGGCGGCGCGGGG - Intronic
1056470728 9:86902799-86902821 CCGGCCTCTGCGGGGGCGCGCGG + Intergenic
1058971706 9:110089153-110089175 AAGGGCACTGGGGAGGCGGATGG + Intronic
1059102463 9:111483762-111483784 AGCGGCTCCGCAGAGGCGCGAGG - Intronic
1059349539 9:113654748-113654770 AAGGGGGCTGCGGAGGCCGGCGG - Intergenic
1060552820 9:124493663-124493685 GAGAGCTCTGCGTAGGCCCGGGG - Intronic
1060676245 9:125517739-125517761 ATGGGCTCTGGGGAGGAGCAGGG + Intronic
1060881580 9:127121837-127121859 AAGCGCTGTGCTGAGGCGCTGGG - Intronic
1061257213 9:129459987-129460009 AAGGCGGCTGCGGAGGCGGGAGG + Intergenic
1062103634 9:134740962-134740984 AAGGGCCCTGGGGAGGCCGGTGG - Intronic
1062447802 9:136602953-136602975 AAGGGGTCTGAGGAGGCCCCTGG - Intergenic
1062472447 9:136712461-136712483 AGGGTCGCGGCGGAGGCGCGCGG - Intergenic
1062549447 9:137079206-137079228 GAGGGCTGGGCGGAGGGGCGGGG - Intronic
1203785606 EBV:125899-125921 ATGGGGTCTGCGGAGAGGCGTGG - Intergenic
1198705833 X:139447123-139447145 GGGCGCGCTGCGGAGGCGCGGGG - Intergenic
1199203866 X:145124596-145124618 AAGGAATCTGCGAAGGCGTGGGG + Intergenic
1200090912 X:153635538-153635560 CTGGGCTCTGGGGAGGCGGGTGG + Intergenic