ID: 1137531439

View in Genome Browser
Species Human (GRCh38)
Location 16:49281235-49281257
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 26
Summary {0: 2, 1: 1, 2: 0, 3: 2, 4: 21}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137531434_1137531439 11 Left 1137531434 16:49281201-49281223 CCTGGTCGAAGTAGATGATCATG 0: 1
1: 0
2: 1
3: 8
4: 66
Right 1137531439 16:49281235-49281257 CATCTCGGACGGCTCGTGGTTGG 0: 2
1: 1
2: 0
3: 2
4: 21

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062854800 10:774555-774577 CGTCTCTGGGGGCTCGTGGTGGG + Intergenic
1091641261 12:2239374-2239396 CATCTCGTAAGGCTCTTGGTGGG + Intronic
1106017688 13:25884828-25884850 GATCTGGGATGGCTCGTGGGAGG - Intronic
1114213110 14:20632739-20632761 CATCTCAGGCGGCCTGTGGTTGG - Intergenic
1137531439 16:49281235-49281257 CATCTCGGACGGCTCGTGGTTGG + Exonic
1143579853 17:7819089-7819111 CATCTTGGATGGCTGGTGGGAGG - Intronic
1151737202 17:75950878-75950900 CATGTCGGATGGCTTGTGGTGGG - Exonic
1152609712 17:81309661-81309683 CATCTGGGGCGCCTCGGGGTAGG + Intergenic
1159770408 18:72541837-72541859 CATCTCGGACGGCTCGTGGTTGG + Exonic
1160512977 18:79462900-79462922 CATCTCGGGCGGCTGGAGGCAGG + Intronic
936079518 2:109422867-109422889 CATCTCGGATGGCTCCTGCAGGG - Intronic
944544737 2:200788029-200788051 CATCTTGAACGGCTAGTGTTTGG - Intergenic
1175036206 20:56003914-56003936 CATCTCGGATGGCTCGTGGTTGG + Exonic
1179884214 21:44306552-44306574 CATCTCAGAGGGCGGGTGGTGGG - Intronic
962755961 3:138465580-138465602 CATCTGGGAAGGTTTGTGGTAGG - Intronic
976431212 4:84965934-84965956 CGTCGCGGACGGGTCGGGGTCGG - Intronic
994320802 5:98392461-98392483 CAGCTCGGACAGCTTGCGGTTGG + Intergenic
997028375 5:130092983-130093005 CATCTGGGAGGCCTCATGGTTGG + Intronic
997284142 5:132666371-132666393 CATCTCGGATTGGTGGTGGTGGG - Intergenic
1000385384 5:160670298-160670320 CATCTCAGAGGGCTGCTGGTAGG + Intronic
1003603819 6:7542068-7542090 GAACTCGGACGGCTACTGGTGGG + Exonic
1026905786 7:74062011-74062033 CCTCTGGGCTGGCTCGTGGTGGG - Intronic
1041316563 8:56569319-56569341 CATCTAGGAAGGCTCAAGGTAGG - Intergenic
1044839516 8:96326002-96326024 CATCTGGGAGGTTTCGTGGTGGG - Intronic
1185734941 X:2489325-2489347 GATCTCGGGCGTCTCCTGGTAGG + Exonic
1190334002 X:49251829-49251851 CATGTCAGATGGCTCGGGGTAGG - Intronic