ID: 1137531752

View in Genome Browser
Species Human (GRCh38)
Location 16:49282382-49282404
Sequence GGTCCCGGCGGCCGGGGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137531736_1137531752 30 Left 1137531736 16:49282329-49282351 CCCAGCGGGCGCGGGCGCGAGGG No data
Right 1137531752 16:49282382-49282404 GGTCCCGGCGGCCGGGGTGCAGG No data
1137531738_1137531752 29 Left 1137531738 16:49282330-49282352 CCAGCGGGCGCGGGCGCGAGGGC No data
Right 1137531752 16:49282382-49282404 GGTCCCGGCGGCCGGGGTGCAGG No data
1137531743_1137531752 4 Left 1137531743 16:49282355-49282377 CCGGCGCGCTGGGCGAGCCTGGC No data
Right 1137531752 16:49282382-49282404 GGTCCCGGCGGCCGGGGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137531752 Original CRISPR GGTCCCGGCGGCCGGGGTGC AGG Intergenic