ID: 1137531752 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 16:49282382-49282404 |
Sequence | GGTCCCGGCGGCCGGGGTGC AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1137531736_1137531752 | 30 | Left | 1137531736 | 16:49282329-49282351 | CCCAGCGGGCGCGGGCGCGAGGG | No data | ||
Right | 1137531752 | 16:49282382-49282404 | GGTCCCGGCGGCCGGGGTGCAGG | No data | ||||
1137531738_1137531752 | 29 | Left | 1137531738 | 16:49282330-49282352 | CCAGCGGGCGCGGGCGCGAGGGC | No data | ||
Right | 1137531752 | 16:49282382-49282404 | GGTCCCGGCGGCCGGGGTGCAGG | No data | ||||
1137531743_1137531752 | 4 | Left | 1137531743 | 16:49282355-49282377 | CCGGCGCGCTGGGCGAGCCTGGC | No data | ||
Right | 1137531752 | 16:49282382-49282404 | GGTCCCGGCGGCCGGGGTGCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1137531752 | Original CRISPR | GGTCCCGGCGGCCGGGGTGC AGG | Intergenic | ||