ID: 1137532445

View in Genome Browser
Species Human (GRCh38)
Location 16:49287949-49287971
Sequence CTGAAGATGGAGAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137532445_1137532454 -4 Left 1137532445 16:49287949-49287971 CCTTCCTCCTTCTCCATCTTCAG No data
Right 1137532454 16:49287968-49287990 TCAGGGGGAGGTTTGCCAGTCGG No data
1137532445_1137532455 -1 Left 1137532445 16:49287949-49287971 CCTTCCTCCTTCTCCATCTTCAG No data
Right 1137532455 16:49287971-49287993 GGGGGAGGTTTGCCAGTCGGTGG No data
1137532445_1137532456 0 Left 1137532445 16:49287949-49287971 CCTTCCTCCTTCTCCATCTTCAG No data
Right 1137532456 16:49287972-49287994 GGGGAGGTTTGCCAGTCGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137532445 Original CRISPR CTGAAGATGGAGAAGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr