ID: 1137533065

View in Genome Browser
Species Human (GRCh38)
Location 16:49295734-49295756
Sequence TTGGCGCCCCAGCAAGATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 57}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137533065_1137533071 12 Left 1137533065 16:49295734-49295756 CCTTCATCTTGCTGGGGCGCCAA 0: 1
1: 0
2: 0
3: 5
4: 57
Right 1137533071 16:49295769-49295791 GCGGCTCTTGGGAGCAGCCTTGG 0: 1
1: 0
2: 2
3: 11
4: 185
1137533065_1137533069 0 Left 1137533065 16:49295734-49295756 CCTTCATCTTGCTGGGGCGCCAA 0: 1
1: 0
2: 0
3: 5
4: 57
Right 1137533069 16:49295757-49295779 TTCAGTGATGGAGCGGCTCTTGG 0: 1
1: 0
2: 0
3: 10
4: 83
1137533065_1137533070 1 Left 1137533065 16:49295734-49295756 CCTTCATCTTGCTGGGGCGCCAA 0: 1
1: 0
2: 0
3: 5
4: 57
Right 1137533070 16:49295758-49295780 TCAGTGATGGAGCGGCTCTTGGG 0: 1
1: 0
2: 0
3: 12
4: 79
1137533065_1137533067 -7 Left 1137533065 16:49295734-49295756 CCTTCATCTTGCTGGGGCGCCAA 0: 1
1: 0
2: 0
3: 5
4: 57
Right 1137533067 16:49295750-49295772 GCGCCAATTCAGTGATGGAGCGG 0: 1
1: 0
2: 0
3: 1
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137533065 Original CRISPR TTGGCGCCCCAGCAAGATGA AGG (reversed) Intergenic
901110167 1:6786793-6786815 TGGGCGCCCCAATAAGATGTAGG + Intronic
901725680 1:11240201-11240223 TTAGCACCCCAGCAAGATCCAGG + Intronic
902350507 1:15850011-15850033 TTGGCCCCTCTGCAAGATGAGGG + Intronic
903779757 1:25813828-25813850 ATTGCACCCCAGCAAGATGTGGG + Intronic
905338342 1:37260612-37260634 TTGGAGCCCCAGAAGGTTGAGGG + Intergenic
908170774 1:61502333-61502355 TTTGCTCACCAGCAACATGAGGG + Intergenic
909502422 1:76349868-76349890 TTGTCTGTCCAGCAAGATGAGGG + Intronic
911422114 1:97656194-97656216 CTGGCAGCCCAGCAAGAAGAAGG + Intronic
920176563 1:204105370-204105392 TTAGCGCCCCAGCTGGCTGAAGG + Intronic
1065251374 10:23818504-23818526 TAGTAGCCCCAGCAAGAGGAAGG + Intronic
1067760200 10:49039251-49039273 TTGGGGTCTCAGCAGGATGAGGG + Intronic
1090095151 11:123735462-123735484 TTGGCAGCCTAGGAAGATGAAGG + Intronic
1099289872 12:80763193-80763215 ATGGCACTCCAGGAAGATGAAGG + Intergenic
1107963058 13:45575909-45575931 TTGGGCCCCCAGGAAAATGATGG + Intronic
1111827106 13:93281359-93281381 TTTGTTCTCCAGCAAGATGATGG - Intronic
1133504395 16:6397093-6397115 TTGGAGTCCCAGAAAGAGGAAGG + Intronic
1135862606 16:26070582-26070604 TTGGCAACCAAGCAAAATGATGG + Intronic
1137533065 16:49295734-49295756 TTGGCGCCCCAGCAAGATGAAGG - Intergenic
1139520835 16:67481794-67481816 TTGGCGCCCTATGCAGATGAAGG - Intergenic
1146551658 17:33785526-33785548 TTGGCTCAACAGCAAGGTGAAGG - Intronic
1147264478 17:39226222-39226244 TTGGGGCCGCAGCAAGATAGCGG + Intergenic
1147634537 17:41955385-41955407 ATGGCGCCCAAGCAGGCTGAGGG - Intronic
1156953687 18:42935925-42935947 TTGGCGCCCTATGCAGATGAAGG + Intronic
1162753557 19:12843563-12843585 TTGGTGCCATAGCCAGATGAAGG - Exonic
1163424046 19:17231227-17231249 TTGGAGCCCAAACAAGATTAAGG + Intergenic
1165780587 19:38431545-38431567 TTGGTCCCCCAGGAAGCTGAGGG - Intergenic
925142999 2:1562722-1562744 TTTGTGCCTCAGCAAGATGATGG - Intergenic
925438808 2:3866394-3866416 TTGGGGCCTCAGCAAGGGGAAGG + Intergenic
930067399 2:47338225-47338247 TTGGAGCCCCCCCAAAATGAGGG + Intergenic
933278967 2:80311398-80311420 TCGGGGCCCCAGCCAGATGAAGG - Intronic
935145533 2:100392705-100392727 TTGTCGCAGCACCAAGATGAAGG + Exonic
938707399 2:133944529-133944551 TTGTCACCCTAGCAAGAAGAGGG - Intergenic
948843980 2:240674501-240674523 TTGGAGCCCCAGGAAGGAGAGGG - Intergenic
948849832 2:240700134-240700156 TTGGAGCCCCAGGAAGGAGAGGG + Intergenic
1170001637 20:11621268-11621290 TTGGCGCCTCAGCACTATGGGGG + Intergenic
1171096565 20:22337588-22337610 TTGGTAGCACAGCAAGATGAAGG + Intergenic
1181857915 22:25795696-25795718 GTGGCGGCCCAGAAATATGATGG + Intronic
1184633660 22:45807468-45807490 CTGGCTCCCTAGCAAGAGGAAGG + Intronic
952855675 3:37768965-37768987 TTGGAACCCCAGCCAGCTGATGG + Intronic
954580867 3:51702348-51702370 CTGGGGCCTCAGCAAGAGGAGGG + Intronic
961360064 3:126361361-126361383 TAGGGGGCCCAGCAGGATGACGG + Intergenic
968999754 4:3970634-3970656 TTGGGGCCCCAGCAGGCTGGAGG - Intergenic
969496777 4:7530764-7530786 TTGGCTGCCCAGCAAGAAGAGGG - Intronic
973729055 4:53805500-53805522 TTGAAGTCCCAGCAAAATGATGG + Intronic
978564995 4:110072085-110072107 TAGGTGCTCCAGCAAGTTGACGG - Intronic
982438031 4:155400063-155400085 GGGGAGCCACAGCAAGATGAGGG - Intergenic
986395570 5:7326161-7326183 TTGCTGCTTCAGCAAGATGAGGG - Intergenic
990709972 5:58569709-58569731 TTGGAGGCGCAGGAAGATGAAGG - Intergenic
996077568 5:119214930-119214952 TTGGCGACAGAGAAAGATGATGG - Intronic
997695374 5:135857083-135857105 TTGGCGTCCCAGCTGGGTGAGGG - Intronic
998629082 5:143878431-143878453 TTGGCGCCCTATGCAGATGAAGG - Intergenic
1018545888 6:164934781-164934803 CAGGCGCCTCAGCAGGATGAGGG + Intergenic
1028882316 7:95893613-95893635 ATGGAGTGCCAGCAAGATGATGG - Intronic
1037579871 8:20238799-20238821 TTGGAGGCCCAGCCAGATGAAGG + Intergenic
1039859912 8:41448207-41448229 TTGGAGACCCAGTAAGATCAAGG - Intergenic
1041141200 8:54820948-54820970 TAGGCGAAGCAGCAAGATGAGGG + Intergenic
1051722280 9:20049943-20049965 GTGGCACACCAGCAAGATTATGG - Intergenic
1057859341 9:98627277-98627299 TTGGCCTCCGAGGAAGATGATGG - Intronic
1058633810 9:107017278-107017300 CTGGTGCCCCAGAAAGTTGAAGG + Intergenic
1059327136 9:113510982-113511004 TTGGCAGCCCAGCCAGAGGAGGG - Intronic
1060204602 9:121675112-121675134 TTGGCGACTCAGCAGGAAGATGG - Intronic
1061958572 9:133976452-133976474 TTGGAGCCCTAGTAAGAAGATGG + Intronic
1185660810 X:1727578-1727600 TTGGTGCCCCAGCCATGTGATGG + Intergenic