ID: 1137533926

View in Genome Browser
Species Human (GRCh38)
Location 16:49302946-49302968
Sequence AGAATTGGAAGAAGGCCGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137533926_1137533934 29 Left 1137533926 16:49302946-49302968 CCAATCGGCCTTCTTCCAATTCT No data
Right 1137533934 16:49302998-49303020 GCACATGCTAAGTCTCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137533926 Original CRISPR AGAATTGGAAGAAGGCCGAT TGG (reversed) Intergenic
No off target data available for this crispr