ID: 1137533927

View in Genome Browser
Species Human (GRCh38)
Location 16:49302954-49302976
Sequence AGTAGCGAAGAATTGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137533927_1137533934 21 Left 1137533927 16:49302954-49302976 CCTTCTTCCAATTCTTCGCTACT No data
Right 1137533934 16:49302998-49303020 GCACATGCTAAGTCTCTGCCTGG No data
1137533927_1137533935 25 Left 1137533927 16:49302954-49302976 CCTTCTTCCAATTCTTCGCTACT No data
Right 1137533935 16:49303002-49303024 ATGCTAAGTCTCTGCCTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137533927 Original CRISPR AGTAGCGAAGAATTGGAAGA AGG (reversed) Intergenic
No off target data available for this crispr