ID: 1137533929

View in Genome Browser
Species Human (GRCh38)
Location 16:49302979-49303001
Sequence GTGCAAGAGCTCAGGGACAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137533929_1137533935 0 Left 1137533929 16:49302979-49303001 CCCCTGTCCCTGAGCTCTTGCAC No data
Right 1137533935 16:49303002-49303024 ATGCTAAGTCTCTGCCTGGAAGG No data
1137533929_1137533934 -4 Left 1137533929 16:49302979-49303001 CCCCTGTCCCTGAGCTCTTGCAC No data
Right 1137533934 16:49302998-49303020 GCACATGCTAAGTCTCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137533929 Original CRISPR GTGCAAGAGCTCAGGGACAG GGG (reversed) Intergenic
No off target data available for this crispr