ID: 1137533934

View in Genome Browser
Species Human (GRCh38)
Location 16:49302998-49303020
Sequence GCACATGCTAAGTCTCTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137533929_1137533934 -4 Left 1137533929 16:49302979-49303001 CCCCTGTCCCTGAGCTCTTGCAC No data
Right 1137533934 16:49302998-49303020 GCACATGCTAAGTCTCTGCCTGG No data
1137533928_1137533934 14 Left 1137533928 16:49302961-49302983 CCAATTCTTCGCTACTTTCCCCT No data
Right 1137533934 16:49302998-49303020 GCACATGCTAAGTCTCTGCCTGG No data
1137533930_1137533934 -5 Left 1137533930 16:49302980-49303002 CCCTGTCCCTGAGCTCTTGCACA No data
Right 1137533934 16:49302998-49303020 GCACATGCTAAGTCTCTGCCTGG No data
1137533931_1137533934 -6 Left 1137533931 16:49302981-49303003 CCTGTCCCTGAGCTCTTGCACAT No data
Right 1137533934 16:49302998-49303020 GCACATGCTAAGTCTCTGCCTGG No data
1137533927_1137533934 21 Left 1137533927 16:49302954-49302976 CCTTCTTCCAATTCTTCGCTACT No data
Right 1137533934 16:49302998-49303020 GCACATGCTAAGTCTCTGCCTGG No data
1137533926_1137533934 29 Left 1137533926 16:49302946-49302968 CCAATCGGCCTTCTTCCAATTCT No data
Right 1137533934 16:49302998-49303020 GCACATGCTAAGTCTCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137533934 Original CRISPR GCACATGCTAAGTCTCTGCC TGG Intergenic
No off target data available for this crispr