ID: 1137538466

View in Genome Browser
Species Human (GRCh38)
Location 16:49345257-49345279
Sequence CCTCATTATCAGCTAATGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137538466_1137538470 20 Left 1137538466 16:49345257-49345279 CCATGCATTAGCTGATAATGAGG No data
Right 1137538470 16:49345300-49345322 ATCAGCCACCTCATTAAACTGGG No data
1137538466_1137538469 19 Left 1137538466 16:49345257-49345279 CCATGCATTAGCTGATAATGAGG No data
Right 1137538469 16:49345299-49345321 CATCAGCCACCTCATTAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137538466 Original CRISPR CCTCATTATCAGCTAATGCA TGG (reversed) Intergenic
No off target data available for this crispr