ID: 1137540807

View in Genome Browser
Species Human (GRCh38)
Location 16:49360377-49360399
Sequence TGAGGAGGTGCTTTGGGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137540807_1137540822 27 Left 1137540807 16:49360377-49360399 CCCAGCCCCAAAGCACCTCCTCA No data
Right 1137540822 16:49360427-49360449 TGGTGATGATGACCTGCGGGAGG No data
1137540807_1137540823 30 Left 1137540807 16:49360377-49360399 CCCAGCCCCAAAGCACCTCCTCA No data
Right 1137540823 16:49360430-49360452 TGATGATGACCTGCGGGAGGAGG No data
1137540807_1137540815 7 Left 1137540807 16:49360377-49360399 CCCAGCCCCAAAGCACCTCCTCA No data
Right 1137540815 16:49360407-49360429 TTGCCTCCCTGCTCCAGCTGTGG No data
1137540807_1137540821 24 Left 1137540807 16:49360377-49360399 CCCAGCCCCAAAGCACCTCCTCA No data
Right 1137540821 16:49360424-49360446 CTGTGGTGATGATGACCTGCGGG No data
1137540807_1137540820 23 Left 1137540807 16:49360377-49360399 CCCAGCCCCAAAGCACCTCCTCA No data
Right 1137540820 16:49360423-49360445 GCTGTGGTGATGATGACCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137540807 Original CRISPR TGAGGAGGTGCTTTGGGGCT GGG (reversed) Intergenic
No off target data available for this crispr