ID: 1137540816

View in Genome Browser
Species Human (GRCh38)
Location 16:49360410-49360432
Sequence TCACCACAGCTGGAGCAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137540816_1137540827 10 Left 1137540816 16:49360410-49360432 CCTCCCTGCTCCAGCTGTGGTGA No data
Right 1137540827 16:49360443-49360465 CGGGAGGAGGAACCAGGGTGAGG No data
1137540816_1137540825 5 Left 1137540816 16:49360410-49360432 CCTCCCTGCTCCAGCTGTGGTGA No data
Right 1137540825 16:49360438-49360460 ACCTGCGGGAGGAGGAACCAGGG No data
1137540816_1137540820 -10 Left 1137540816 16:49360410-49360432 CCTCCCTGCTCCAGCTGTGGTGA No data
Right 1137540820 16:49360423-49360445 GCTGTGGTGATGATGACCTGCGG No data
1137540816_1137540823 -3 Left 1137540816 16:49360410-49360432 CCTCCCTGCTCCAGCTGTGGTGA No data
Right 1137540823 16:49360430-49360452 TGATGATGACCTGCGGGAGGAGG No data
1137540816_1137540822 -6 Left 1137540816 16:49360410-49360432 CCTCCCTGCTCCAGCTGTGGTGA No data
Right 1137540822 16:49360427-49360449 TGGTGATGATGACCTGCGGGAGG No data
1137540816_1137540821 -9 Left 1137540816 16:49360410-49360432 CCTCCCTGCTCCAGCTGTGGTGA No data
Right 1137540821 16:49360424-49360446 CTGTGGTGATGATGACCTGCGGG No data
1137540816_1137540824 4 Left 1137540816 16:49360410-49360432 CCTCCCTGCTCCAGCTGTGGTGA No data
Right 1137540824 16:49360437-49360459 GACCTGCGGGAGGAGGAACCAGG No data
1137540816_1137540828 21 Left 1137540816 16:49360410-49360432 CCTCCCTGCTCCAGCTGTGGTGA No data
Right 1137540828 16:49360454-49360476 ACCAGGGTGAGGACATTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137540816 Original CRISPR TCACCACAGCTGGAGCAGGG AGG (reversed) Intergenic
No off target data available for this crispr