ID: 1137540818

View in Genome Browser
Species Human (GRCh38)
Location 16:49360414-49360436
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137540818_1137540822 -10 Left 1137540818 16:49360414-49360436 CCTGCTCCAGCTGTGGTGATGAT No data
Right 1137540822 16:49360427-49360449 TGGTGATGATGACCTGCGGGAGG No data
1137540818_1137540824 0 Left 1137540818 16:49360414-49360436 CCTGCTCCAGCTGTGGTGATGAT No data
Right 1137540824 16:49360437-49360459 GACCTGCGGGAGGAGGAACCAGG No data
1137540818_1137540827 6 Left 1137540818 16:49360414-49360436 CCTGCTCCAGCTGTGGTGATGAT No data
Right 1137540827 16:49360443-49360465 CGGGAGGAGGAACCAGGGTGAGG No data
1137540818_1137540823 -7 Left 1137540818 16:49360414-49360436 CCTGCTCCAGCTGTGGTGATGAT No data
Right 1137540823 16:49360430-49360452 TGATGATGACCTGCGGGAGGAGG No data
1137540818_1137540828 17 Left 1137540818 16:49360414-49360436 CCTGCTCCAGCTGTGGTGATGAT No data
Right 1137540828 16:49360454-49360476 ACCAGGGTGAGGACATTGCCTGG No data
1137540818_1137540825 1 Left 1137540818 16:49360414-49360436 CCTGCTCCAGCTGTGGTGATGAT No data
Right 1137540825 16:49360438-49360460 ACCTGCGGGAGGAGGAACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137540818 Original CRISPR ATCATCACCACAGCTGGAGC AGG (reversed) Intergenic
No off target data available for this crispr