ID: 1137540819

View in Genome Browser
Species Human (GRCh38)
Location 16:49360420-49360442
Sequence CAGGTCATCATCACCACAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137540819_1137540825 -5 Left 1137540819 16:49360420-49360442 CCAGCTGTGGTGATGATGACCTG No data
Right 1137540825 16:49360438-49360460 ACCTGCGGGAGGAGGAACCAGGG No data
1137540819_1137540828 11 Left 1137540819 16:49360420-49360442 CCAGCTGTGGTGATGATGACCTG No data
Right 1137540828 16:49360454-49360476 ACCAGGGTGAGGACATTGCCTGG No data
1137540819_1137540824 -6 Left 1137540819 16:49360420-49360442 CCAGCTGTGGTGATGATGACCTG No data
Right 1137540824 16:49360437-49360459 GACCTGCGGGAGGAGGAACCAGG No data
1137540819_1137540827 0 Left 1137540819 16:49360420-49360442 CCAGCTGTGGTGATGATGACCTG No data
Right 1137540827 16:49360443-49360465 CGGGAGGAGGAACCAGGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137540819 Original CRISPR CAGGTCATCATCACCACAGC TGG (reversed) Intergenic
No off target data available for this crispr