ID: 1137540822

View in Genome Browser
Species Human (GRCh38)
Location 16:49360427-49360449
Sequence TGGTGATGATGACCTGCGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137540807_1137540822 27 Left 1137540807 16:49360377-49360399 CCCAGCCCCAAAGCACCTCCTCA No data
Right 1137540822 16:49360427-49360449 TGGTGATGATGACCTGCGGGAGG No data
1137540818_1137540822 -10 Left 1137540818 16:49360414-49360436 CCTGCTCCAGCTGTGGTGATGAT No data
Right 1137540822 16:49360427-49360449 TGGTGATGATGACCTGCGGGAGG No data
1137540810_1137540822 22 Left 1137540810 16:49360382-49360404 CCCCAAAGCACCTCCTCATGGAT No data
Right 1137540822 16:49360427-49360449 TGGTGATGATGACCTGCGGGAGG No data
1137540813_1137540822 12 Left 1137540813 16:49360392-49360414 CCTCCTCATGGATTCTTGCCTCC No data
Right 1137540822 16:49360427-49360449 TGGTGATGATGACCTGCGGGAGG No data
1137540808_1137540822 26 Left 1137540808 16:49360378-49360400 CCAGCCCCAAAGCACCTCCTCAT No data
Right 1137540822 16:49360427-49360449 TGGTGATGATGACCTGCGGGAGG No data
1137540816_1137540822 -6 Left 1137540816 16:49360410-49360432 CCTCCCTGCTCCAGCTGTGGTGA No data
Right 1137540822 16:49360427-49360449 TGGTGATGATGACCTGCGGGAGG No data
1137540811_1137540822 21 Left 1137540811 16:49360383-49360405 CCCAAAGCACCTCCTCATGGATT No data
Right 1137540822 16:49360427-49360449 TGGTGATGATGACCTGCGGGAGG No data
1137540817_1137540822 -9 Left 1137540817 16:49360413-49360435 CCCTGCTCCAGCTGTGGTGATGA No data
Right 1137540822 16:49360427-49360449 TGGTGATGATGACCTGCGGGAGG No data
1137540814_1137540822 9 Left 1137540814 16:49360395-49360417 CCTCATGGATTCTTGCCTCCCTG No data
Right 1137540822 16:49360427-49360449 TGGTGATGATGACCTGCGGGAGG No data
1137540812_1137540822 20 Left 1137540812 16:49360384-49360406 CCAAAGCACCTCCTCATGGATTC No data
Right 1137540822 16:49360427-49360449 TGGTGATGATGACCTGCGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137540822 Original CRISPR TGGTGATGATGACCTGCGGG AGG Intergenic
No off target data available for this crispr