ID: 1137540825

View in Genome Browser
Species Human (GRCh38)
Location 16:49360438-49360460
Sequence ACCTGCGGGAGGAGGAACCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137540816_1137540825 5 Left 1137540816 16:49360410-49360432 CCTCCCTGCTCCAGCTGTGGTGA No data
Right 1137540825 16:49360438-49360460 ACCTGCGGGAGGAGGAACCAGGG No data
1137540818_1137540825 1 Left 1137540818 16:49360414-49360436 CCTGCTCCAGCTGTGGTGATGAT No data
Right 1137540825 16:49360438-49360460 ACCTGCGGGAGGAGGAACCAGGG No data
1137540817_1137540825 2 Left 1137540817 16:49360413-49360435 CCCTGCTCCAGCTGTGGTGATGA No data
Right 1137540825 16:49360438-49360460 ACCTGCGGGAGGAGGAACCAGGG No data
1137540819_1137540825 -5 Left 1137540819 16:49360420-49360442 CCAGCTGTGGTGATGATGACCTG No data
Right 1137540825 16:49360438-49360460 ACCTGCGGGAGGAGGAACCAGGG No data
1137540814_1137540825 20 Left 1137540814 16:49360395-49360417 CCTCATGGATTCTTGCCTCCCTG No data
Right 1137540825 16:49360438-49360460 ACCTGCGGGAGGAGGAACCAGGG No data
1137540813_1137540825 23 Left 1137540813 16:49360392-49360414 CCTCCTCATGGATTCTTGCCTCC No data
Right 1137540825 16:49360438-49360460 ACCTGCGGGAGGAGGAACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137540825 Original CRISPR ACCTGCGGGAGGAGGAACCA GGG Intergenic
No off target data available for this crispr