ID: 1137540828

View in Genome Browser
Species Human (GRCh38)
Location 16:49360454-49360476
Sequence ACCAGGGTGAGGACATTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137540819_1137540828 11 Left 1137540819 16:49360420-49360442 CCAGCTGTGGTGATGATGACCTG No data
Right 1137540828 16:49360454-49360476 ACCAGGGTGAGGACATTGCCTGG No data
1137540826_1137540828 -8 Left 1137540826 16:49360439-49360461 CCTGCGGGAGGAGGAACCAGGGT No data
Right 1137540828 16:49360454-49360476 ACCAGGGTGAGGACATTGCCTGG No data
1137540817_1137540828 18 Left 1137540817 16:49360413-49360435 CCCTGCTCCAGCTGTGGTGATGA No data
Right 1137540828 16:49360454-49360476 ACCAGGGTGAGGACATTGCCTGG No data
1137540816_1137540828 21 Left 1137540816 16:49360410-49360432 CCTCCCTGCTCCAGCTGTGGTGA No data
Right 1137540828 16:49360454-49360476 ACCAGGGTGAGGACATTGCCTGG No data
1137540818_1137540828 17 Left 1137540818 16:49360414-49360436 CCTGCTCCAGCTGTGGTGATGAT No data
Right 1137540828 16:49360454-49360476 ACCAGGGTGAGGACATTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137540828 Original CRISPR ACCAGGGTGAGGACATTGCC TGG Intergenic
No off target data available for this crispr