ID: 1137543062

View in Genome Browser
Species Human (GRCh38)
Location 16:49377884-49377906
Sequence CTGGGTCTCCAAATGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 460
Summary {0: 1, 1: 1, 2: 4, 3: 47, 4: 407}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137543047_1137543062 0 Left 1137543047 16:49377861-49377883 CCCTCTTCCCCCACTCACCCCCA 0: 1
1: 1
2: 8
3: 161
4: 1407
Right 1137543062 16:49377884-49377906 CTGGGTCTCCAAATGGAGGAGGG 0: 1
1: 1
2: 4
3: 47
4: 407
1137543052_1137543062 -8 Left 1137543052 16:49377869-49377891 CCCCACTCACCCCCACTGGGTCT 0: 1
1: 0
2: 2
3: 24
4: 380
Right 1137543062 16:49377884-49377906 CTGGGTCTCCAAATGGAGGAGGG 0: 1
1: 1
2: 4
3: 47
4: 407
1137543045_1137543062 17 Left 1137543045 16:49377844-49377866 CCAGCAGGTAATGCAGCCCCTCT 0: 1
1: 0
2: 3
3: 20
4: 213
Right 1137543062 16:49377884-49377906 CTGGGTCTCCAAATGGAGGAGGG 0: 1
1: 1
2: 4
3: 47
4: 407
1137543054_1137543062 -10 Left 1137543054 16:49377871-49377893 CCACTCACCCCCACTGGGTCTCC 0: 1
1: 0
2: 1
3: 27
4: 410
Right 1137543062 16:49377884-49377906 CTGGGTCTCCAAATGGAGGAGGG 0: 1
1: 1
2: 4
3: 47
4: 407
1137543053_1137543062 -9 Left 1137543053 16:49377870-49377892 CCCACTCACCCCCACTGGGTCTC 0: 1
1: 0
2: 2
3: 17
4: 262
Right 1137543062 16:49377884-49377906 CTGGGTCTCCAAATGGAGGAGGG 0: 1
1: 1
2: 4
3: 47
4: 407
1137543048_1137543062 -1 Left 1137543048 16:49377862-49377884 CCTCTTCCCCCACTCACCCCCAC 0: 1
1: 1
2: 14
3: 237
4: 1880
Right 1137543062 16:49377884-49377906 CTGGGTCTCCAAATGGAGGAGGG 0: 1
1: 1
2: 4
3: 47
4: 407
1137543044_1137543062 18 Left 1137543044 16:49377843-49377865 CCCAGCAGGTAATGCAGCCCCTC 0: 1
1: 0
2: 0
3: 16
4: 136
Right 1137543062 16:49377884-49377906 CTGGGTCTCCAAATGGAGGAGGG 0: 1
1: 1
2: 4
3: 47
4: 407
1137543046_1137543062 1 Left 1137543046 16:49377860-49377882 CCCCTCTTCCCCCACTCACCCCC 0: 1
1: 1
2: 17
3: 183
4: 1801
Right 1137543062 16:49377884-49377906 CTGGGTCTCCAAATGGAGGAGGG 0: 1
1: 1
2: 4
3: 47
4: 407
1137543051_1137543062 -7 Left 1137543051 16:49377868-49377890 CCCCCACTCACCCCCACTGGGTC 0: 1
1: 0
2: 0
3: 34
4: 370
Right 1137543062 16:49377884-49377906 CTGGGTCTCCAAATGGAGGAGGG 0: 1
1: 1
2: 4
3: 47
4: 407

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137543062 Original CRISPR CTGGGTCTCCAAATGGAGGA GGG Intronic
900437604 1:2639015-2639037 CTGGGTCTCCACATGGTGGAGGG + Intronic
900564730 1:3326670-3326692 CAGGGCCTCCATCTGGAGGAAGG + Intronic
900682856 1:3926407-3926429 CTGGCTTTGCAGATGGAGGAAGG - Intergenic
901152167 1:7111076-7111098 CTGGCTCTCAAGATGGGGGAAGG - Intronic
901252772 1:7793802-7793824 CTGGATCTCAAAATGAAGGAAGG + Intronic
901291395 1:8126928-8126950 CTGTGTCCCCACATGGTGGAAGG - Intergenic
902899753 1:19506778-19506800 CTGTGTCCCCACATGGTGGAAGG + Intergenic
903144535 1:21362504-21362526 CAGGCTCTCCAAAAGGATGAAGG - Intergenic
905258602 1:36701602-36701624 TTGGATCTCCAAATGTTGGAGGG + Intergenic
905350178 1:37340117-37340139 CTGTGTCTTCACATGGTGGAAGG - Intergenic
905858484 1:41330599-41330621 CTGTGTCTCCATATGGAGAGGGG - Intergenic
907052636 1:51340023-51340045 CTGTGTCTTCACATGGAGGAAGG - Intronic
908089597 1:60671819-60671841 CTGTGTCTTCACATGGTGGAAGG - Intergenic
908267361 1:62392585-62392607 CTGTGTCCTCAAATGGTGGAAGG - Intergenic
908596092 1:65690252-65690274 CTGTGTCTCCAACAGGAGGTGGG - Intergenic
908799030 1:67859758-67859780 CTGGCTCTGAAGATGGAGGAAGG + Intergenic
910961650 1:92770025-92770047 CTGGGTTTGAAGATGGAGGATGG + Intronic
914077492 1:144369066-144369088 CTGTGTCCTCACATGGAGGAAGG + Intergenic
914101687 1:144597439-144597461 CTGTGTCCTCACATGGAGGAAGG - Intergenic
915109049 1:153551400-153551422 CTGAGTCTCCAAGGAGAGGACGG - Intergenic
915544050 1:156585965-156585987 CTGGACCTACAAATGGAAGATGG - Exonic
916077254 1:161208984-161209006 CTGGCTCTCCAAAGTGAGGGAGG - Intronic
916094226 1:161334207-161334229 CTGGTTCTGAAGATGGAGGAAGG - Intronic
916162759 1:161935392-161935414 CTGTGTCTTCAAATGGCAGAAGG - Intronic
916671406 1:167024640-167024662 CTGTGTCCCCACATGGTGGAAGG - Intergenic
916784683 1:168077831-168077853 CTTGTTCTCCATATGGAAGAGGG - Intergenic
917030109 1:170681061-170681083 TTGGGTCTCTTAATGGAAGAAGG + Intronic
917652664 1:177094490-177094512 CTGTGTCTCCACATGGTGAAAGG - Intronic
920724986 1:208426668-208426690 CTGTGTCCTCACATGGAGGAAGG + Intergenic
920918363 1:210276941-210276963 CTGTGTCTTCATATGGTGGAAGG - Intergenic
922128406 1:222752526-222752548 CTGGGTCTCCAGTTGGTGAATGG + Intergenic
922978116 1:229801909-229801931 CTGAGTCTCCACATGGTGGAAGG + Intergenic
923280836 1:232441617-232441639 CTGGGTCTCCAGATGCAGGAGGG - Intronic
924047537 1:240047274-240047296 CTGTGTCTTCACATGGTGGAAGG - Intronic
924101571 1:240608801-240608823 TTGGCTCTCCAAAGGGAAGAGGG + Intronic
1062873077 10:923407-923429 CAGGCTCTCCATCTGGAGGAGGG - Intronic
1063023535 10:2154934-2154956 CTGTGTCCCCACATGGTGGAAGG - Intergenic
1063023557 10:2155023-2155045 CTGTGTCTTCACATGGTGGAAGG - Intergenic
1063717897 10:8546700-8546722 CTGGGTCTCCAACTTGCAGATGG - Intergenic
1063960827 10:11304244-11304266 CTGGCTCTGAAGATGGAGGAAGG - Intronic
1065145894 10:22767811-22767833 TTGGGTCACCAAAAGGAAGATGG - Intergenic
1065158485 10:22894735-22894757 CTGGCTCTCCACATGCAGGTAGG + Intergenic
1065554344 10:26899984-26900006 CTGGGTCTCCACTTGTAAGATGG + Intergenic
1065731869 10:28716908-28716930 CTGTGTCACCCCATGGAGGAAGG - Intergenic
1065850097 10:29780721-29780743 CTGGGTATTTAAATGGTGGATGG - Intergenic
1066654692 10:37686962-37686984 CTGGGTCTCCTAGTGCAGGGTGG - Intergenic
1067729030 10:48795819-48795841 CTGGGTCACCAAATGTATGCTGG + Intronic
1068181661 10:53527480-53527502 CTGGGTCTGGAAAGGAAGGAAGG + Intergenic
1068566602 10:58582769-58582791 CTGGCTTTAAAAATGGAGGAAGG - Intronic
1069185727 10:65420268-65420290 CTGGATCTGGAAATGAAGGAAGG - Intergenic
1069586236 10:69604658-69604680 CTGGTTCTCAATATGGTGGATGG - Intergenic
1069592533 10:69650927-69650949 GGGGGTCTCCAGATGGGGGACGG - Intergenic
1069807678 10:71136235-71136257 CTGGGGCTGCAACTGGAGGGAGG - Intergenic
1069888460 10:71638463-71638485 CTGGGCCCCCAAAGGGAGGGAGG - Intronic
1069957137 10:72059155-72059177 CAGGGTCCCCAAGTGGAGGCGGG + Exonic
1070448916 10:76537572-76537594 CTGGCTCTGAAAATGGAGGAAGG - Intronic
1070472424 10:76796004-76796026 CTGGCTTTGAAAATGGAGGAAGG + Intergenic
1071144274 10:82549422-82549444 CTGGGTCTGCACAGGGAGGTGGG + Intronic
1071549150 10:86552861-86552883 CTGTGTCTTCACATGGTGGAAGG - Intergenic
1072070408 10:91909601-91909623 CTGTCTCTCCAGATGGATGATGG + Intergenic
1073141084 10:101248235-101248257 CTGTGTCTTCACATGGAGGAAGG + Intergenic
1074363434 10:112840018-112840040 CTGGATACACAAATGGAGGAGGG + Intergenic
1074480446 10:113815503-113815525 CTGTGTCCTCAAATGGTGGAAGG - Intergenic
1074702654 10:116106085-116106107 CTGGTTCTGAAAATGGAGGAAGG + Intronic
1075535844 10:123271495-123271517 CTGGGTCTCCAACTTGCAGATGG + Intergenic
1075835515 10:125449572-125449594 ATGTGTCACCCAATGGAGGAAGG + Intergenic
1076211068 10:128645398-128645420 CTGTGTCCACAAATGGTGGAAGG + Intergenic
1077201324 11:1309098-1309120 AATGGTCTCCAGATGGAGGAGGG - Intronic
1077805452 11:5587545-5587567 CTGTGTCTTCACATGGAGAAAGG + Intronic
1078988322 11:16616093-16616115 GTGGGTCTATAAATGGAGAAAGG - Intronic
1079195584 11:18323526-18323548 CTGGGTCTTCAAATGGACAAAGG - Intronic
1079461107 11:20678708-20678730 CTGTGTCCTCAAATGGTGGAAGG + Intronic
1079800121 11:24858882-24858904 CTGGATTTCAAAATGGAGGTGGG - Intronic
1080991365 11:37539871-37539893 CTGTGTCTTCACATGGAGGGAGG - Intergenic
1081028366 11:38045009-38045031 GTGGCTCTCCATATGGAGGAGGG - Intergenic
1081062670 11:38500018-38500040 CTGTGTCCTCAAATGGTGGAAGG - Intergenic
1081445576 11:43128785-43128807 CTGTGTCATCACATGGAGGAAGG - Intergenic
1082997663 11:59266366-59266388 CTTGCTGTCCAAATGGAGGGTGG - Intergenic
1084604851 11:70166471-70166493 CAGGGTTTCCAGATGGAGGCTGG + Intronic
1084736858 11:71110977-71110999 CTGTGTCTTCACGTGGAGGAAGG - Intronic
1085040543 11:73324031-73324053 CTGGCTCTCTAAAGGGAGGCAGG - Intronic
1085871825 11:80359116-80359138 CTGGGTCCTCACATGGTGGAAGG + Intergenic
1086923048 11:92609291-92609313 CAGAGGCTCAAAATGGAGGAGGG + Intronic
1087087009 11:94230071-94230093 CTGTGTCTTCACATGGTGGAAGG + Intergenic
1087351544 11:97039931-97039953 TAGGGACTCCAAAAGGAGGAAGG + Intergenic
1090230411 11:125098868-125098890 CTGGCTCTGAAGATGGAGGAAGG + Intronic
1092132497 12:6122625-6122647 CTGGGTCTGCAAATGGCGGGAGG - Intronic
1092529774 12:9334823-9334845 CTGGGACCCCAAAAGGATGAGGG + Intergenic
1092746642 12:11678705-11678727 CTGGGTCTCCAACTTGCAGATGG - Intronic
1092908302 12:13122512-13122534 CTGTGTCACCACATGGTGGAAGG + Intronic
1093350620 12:18095617-18095639 CAGGATCCCCAAATGGTGGAGGG - Intronic
1096038179 12:48491283-48491305 CTGTGTCCTCACATGGAGGAAGG + Intronic
1096741484 12:53696941-53696963 CTGGATCTTGAAATGGAGGAGGG - Intergenic
1098345906 12:69503237-69503259 CTGGCTTTCAAAATGGAGGGGGG - Intronic
1099597181 12:84681908-84681930 CTGGGTCTCCAAATTGTAGATGG + Intergenic
1099871477 12:88355074-88355096 TTGGGTAGCCACATGGAGGATGG - Intergenic
1100593684 12:96053406-96053428 CTGTGTCTTCACATGGTGGAAGG - Intergenic
1100901931 12:99251019-99251041 CTGGGTCCTCACATGGTGGAGGG + Intronic
1101860917 12:108481774-108481796 CTGTGTCCTCACATGGAGGAAGG - Intergenic
1102422765 12:112817140-112817162 CTGGATCTTCAAATGGAAGTTGG + Intronic
1102991632 12:117320378-117320400 CTGGCTTTGAAAATGGAGGAAGG + Intronic
1103581897 12:121921622-121921644 CTGTGTCTCCAAACGGATCATGG - Exonic
1104211416 12:126692218-126692240 CTGGGTCTTCAGATGGTGGGGGG - Intergenic
1104350425 12:128040482-128040504 CTGGATCTGCAAAGGAAGGAAGG - Intergenic
1105811149 13:23996798-23996820 CTGGCTCTGGAGATGGAGGAGGG - Intronic
1105853139 13:24353456-24353478 CTGGGTCTCCAGCTGGCAGATGG - Intergenic
1106016304 13:25872276-25872298 CTGGGTCTCTTATAGGAGGACGG + Intronic
1106473301 13:30076947-30076969 CTGGCTTTGCAGATGGAGGAAGG - Intergenic
1106999352 13:35525834-35525856 CTGTGTCTTCACATGGTGGAAGG + Intronic
1107634102 13:42374598-42374620 CTGTGTCCTCACATGGAGGAAGG + Intergenic
1108161466 13:47644724-47644746 CTGGGTCCTCATATGGTGGAAGG - Intergenic
1108679508 13:52767387-52767409 CTGTGTCTTCACATGGAAGAAGG - Intergenic
1109019258 13:57064526-57064548 CTAGGCTTCCAGATGGAGGAGGG - Intergenic
1109263996 13:60175625-60175647 CTGGATCCCCACATGGTGGAGGG - Intergenic
1109941422 13:69371335-69371357 CTGGGACTACTAATGGAGGGAGG + Intergenic
1109965414 13:69686748-69686770 CTGGCTCTCCAGATTGAAGATGG - Intergenic
1110409221 13:75185480-75185502 CTGGCTTTGAAAATGGAGGAAGG - Intergenic
1110595775 13:77319140-77319162 CTGGATCTGCGAAGGGAGGAAGG - Intronic
1110837525 13:80101599-80101621 CTGGCTTTGAAAATGGAGGAAGG - Intergenic
1111629927 13:90837545-90837567 ATGGGTTTGAAAATGGAGGAGGG - Intergenic
1112912657 13:104507514-104507536 CTGGGTCTCCAAAAGGAGGAAGG - Intergenic
1112998608 13:105604596-105604618 CTGGGCCTTCACATGGTGGAAGG + Intergenic
1116001898 14:39252359-39252381 CTGGCTTTGAAAATGGAGGATGG + Intronic
1116968314 14:51038242-51038264 CTGGTTTTGAAAATGGAGGAAGG + Intronic
1117590955 14:57268369-57268391 CCGGGTGTCCCAAGGGAGGAGGG - Intronic
1118068285 14:62216422-62216444 CTGCGTCTTCACATGGTGGAAGG - Intergenic
1118305919 14:64655322-64655344 CTGCCTCTCCAAATGGAGCAGGG - Intergenic
1118732269 14:68676847-68676869 CTGTGTCTCCACATGCAGGCAGG + Intronic
1119640290 14:76309774-76309796 GTGGGTCTCCAGATGGCAGATGG + Intergenic
1120062384 14:79999466-79999488 CTGAGTCTTCAAATGGAGAAGGG + Intergenic
1120498908 14:85269687-85269709 CTGTGTCTTCACATGGTGGAAGG + Intergenic
1121125525 14:91404284-91404306 CAGGGTCTCAGACTGGAGGAGGG - Intronic
1121853171 14:97242374-97242396 CTGTGTCTTCACATGGTGGAAGG + Intergenic
1122278001 14:100605105-100605127 CCTGGTCTCCACAGGGAGGAGGG + Intergenic
1122513689 14:102290855-102290877 ATGAGTCTCCAAATGGAGGTGGG + Intronic
1122810674 14:104286267-104286289 CTGTGTCCTCACATGGAGGACGG + Intergenic
1124096006 15:26649339-26649361 CTGGGTCATCACATGGTGGAGGG - Intronic
1124716120 15:32063892-32063914 CTGGATCCACAAATGGAGAATGG - Intronic
1125628233 15:41126659-41126681 CTGGCTCTCCAACTGGAAGCTGG + Intergenic
1126047039 15:44651573-44651595 CTGGGTCTCCAAATCCCAGAGGG + Exonic
1126424722 15:48515078-48515100 CTGGCTTTGAAAATGGAGGAAGG + Intronic
1126645042 15:50867449-50867471 CTGGATCTGCAAAGGAAGGAAGG + Intergenic
1127362682 15:58258945-58258967 CTGTGTCTTCACATGGCGGAAGG + Intronic
1128401919 15:67292102-67292124 CTGTGTCTGCACATGGAAGAGGG - Intronic
1128443200 15:67732726-67732748 CTGGAGCTCCATATGGAGCAGGG - Intronic
1129580471 15:76803667-76803689 CTGTGTCTTCACATGGTGGAGGG + Intronic
1130799145 15:87243454-87243476 CTGAGTCTCCACATGGATAAGGG - Intergenic
1131071082 15:89466352-89466374 AGGGGTCTGCAATTGGAGGATGG + Intergenic
1131418314 15:92280248-92280270 CTGATTCTCCATGTGGAGGAAGG - Intergenic
1202954746 15_KI270727v1_random:69252-69274 CAGGGATTTCAAATGGAGGAAGG - Intergenic
1132979016 16:2725442-2725464 CTGGCTCTGCAGATGGAGGAAGG - Intergenic
1135060101 16:19264071-19264093 CTGAGTCCCCACATGGTGGAAGG - Intronic
1135290947 16:21237559-21237581 CTGTGTCCTCACATGGAGGAAGG + Intronic
1135647038 16:24172204-24172226 CTGGGGCTCCAAATGGACAGTGG - Intronic
1137543062 16:49377884-49377906 CTGGGTCTCCAAATGGAGGAGGG + Intronic
1138748240 16:59388677-59388699 CTGAATTTCAAAATGGAGGAGGG + Intergenic
1138954382 16:61953093-61953115 CTGTGTCCCCACATGGTGGAAGG - Intronic
1139557427 16:67721212-67721234 CTGGGCATCCTCATGGAGGAAGG + Intergenic
1140916623 16:79499627-79499649 CTGTGTCTTCATATGGGGGAAGG - Intergenic
1141187867 16:81800935-81800957 CTGGCTCTGAAGATGGAGGAAGG + Intronic
1141263348 16:82473717-82473739 CTGGCTTTCAAGATGGAGGAAGG - Intergenic
1141532966 16:84659517-84659539 CTGAGTCCCCAAAAGGGGGATGG - Intronic
1141808344 16:86357221-86357243 CTGTGTCTCCTAATGCAGAATGG - Intergenic
1142160376 16:88554507-88554529 CTGGCTCTGAAGATGGAGGAGGG - Intergenic
1203143106 16_KI270728v1_random:1781825-1781847 GTGGATCCCCAGATGGAGGATGG + Intergenic
1144411998 17:15010569-15010591 CTGGGACTCCAGGTGGCGGAGGG + Intergenic
1144578172 17:16443027-16443049 CTGGGTCTCCATAAGGAGGTAGG + Intronic
1149436041 17:56634216-56634238 CTGTGTCTACACATGGTGGAAGG + Intergenic
1151315160 17:73317339-73317361 CTGGGGTTGCAAATGGAAGAAGG - Intergenic
1151512881 17:74572200-74572222 CTGTGTCTTCACATGGTGGAAGG + Intergenic
1151814004 17:76462145-76462167 CTGGGTCGGCTAAGGGAGGAAGG + Intronic
1152096675 17:78276699-78276721 CTGGGTCCCCTAAGGGAGTAGGG - Intergenic
1152346377 17:79754855-79754877 CTGTGTCCTCACATGGAGGAAGG + Intergenic
1153304591 18:3620281-3620303 CTGGCTTTGCAGATGGAGGAAGG + Intronic
1154301852 18:13201141-13201163 CTGGCTTTGAAAATGGAGGAAGG - Intergenic
1154447520 18:14447706-14447728 CAGGGATTTCAAATGGAGGAAGG - Intergenic
1155798187 18:30066332-30066354 CTGTTTCTTCACATGGAGGAAGG + Intergenic
1156256248 18:35399505-35399527 CAGGGTCTTTAAATGGAAGAGGG + Intergenic
1156539866 18:37898828-37898850 CTGTGTCCCCAAATGTGGGAAGG - Intergenic
1158077900 18:53552552-53552574 CTGGGACTCCAAATGGGGCAAGG + Intergenic
1159746876 18:72247369-72247391 CTGTTTATGCAAATGGAGGATGG + Intergenic
1160198899 18:76779885-76779907 CTGGCTGTGCAGATGGAGGAAGG + Intergenic
1160537247 18:79601261-79601283 CTGGATCTGCAAAGGAAGGAAGG - Intergenic
1161592928 19:5136832-5136854 CTGGGTCTGGAAATGGGGAAAGG - Intronic
1161673293 19:5626671-5626693 CTGGGAATTCCAATGGAGGATGG + Intronic
1162085129 19:8244133-8244155 CTGGCTCTGAAGATGGAGGAAGG + Intronic
1164562385 19:29301185-29301207 CTGGGCCACCAAGTAGAGGACGG - Intergenic
1166321154 19:42019716-42019738 CTGGTTCTGAAGATGGAGGAAGG + Intronic
1166532917 19:43553252-43553274 CTGGGTCTCAGGGTGGAGGAAGG - Intronic
1167958888 19:53090281-53090303 CTGGGTCTCCAGAGAGATGAAGG - Intronic
1168254610 19:55158542-55158564 CTGGGTTTCCAAGTGGACGAGGG - Intronic
1168449859 19:56457937-56457959 CTGTGTCTGCACATGGAGGAAGG - Intronic
1168721067 19:58555304-58555326 CTGGGTCCTCAAGTGGAGGTTGG - Intergenic
925098164 2:1224057-1224079 CTGTGTCTCCCTGTGGAGGAAGG + Intronic
927871628 2:26627805-26627827 CTGGGTCTTGAAATAGAGGCAGG - Intronic
928041940 2:27887219-27887241 CTGGCTCTGAAGATGGAGGAAGG + Intronic
928309343 2:30196747-30196769 CTGGCTTTGAAAATGGAGGAAGG + Intergenic
928583101 2:32728403-32728425 CTGGGTCTACTAATGGGAGATGG - Intronic
929608724 2:43253961-43253983 CTGGGTCTCCAGAGGGAGACTGG - Intronic
929941796 2:46339827-46339849 CTGTGTCTCCACATGGTGGAAGG + Intronic
930324443 2:49897696-49897718 CTGGGTCTCCAGATTGCAGAGGG - Intergenic
930743327 2:54856339-54856361 CTGAGTCTCCCATTGGAGTAGGG - Intronic
931243483 2:60473338-60473360 CTGGGTCTTCAAAAAGAGAATGG + Intronic
931541389 2:63333406-63333428 CTGGATCTGCAAAGGAAGGAAGG - Intronic
931998207 2:67859099-67859121 CTGAATCACCATATGGAGGATGG + Intergenic
932260572 2:70323474-70323496 CAGGGTCTCTTAATGGAGAAGGG + Intergenic
933572007 2:84025089-84025111 CTGGCTCTGAAGATGGAGGAAGG + Intergenic
933895783 2:86808648-86808670 CTGGGCCCCCAGATGGAAGACGG - Intergenic
935000317 2:99007797-99007819 CTGGCTTTCCAAAGAGAGGAGGG - Intronic
935141539 2:100357554-100357576 CTGGCTTTGAAAATGGAGGAGGG - Intergenic
935180621 2:100687371-100687393 CTGTGTCCTCACATGGAGGAAGG - Intergenic
935190232 2:100771694-100771716 CTGGGTCTCCAGCTGGCAGACGG + Intergenic
935708585 2:105877555-105877577 CTGTGTCTCCAGATGGAAGAGGG - Intronic
936539316 2:113337121-113337143 GTGGGTCTGCTAATGGAGGTGGG + Intergenic
936652759 2:114448432-114448454 ATGGGTCTACAAATGAAGCATGG + Intronic
937024389 2:118685838-118685860 CTGTGTCTCCTGATGGATGATGG - Intergenic
937282785 2:120731751-120731773 CTGAGTCCTCACATGGAGGAAGG - Intergenic
937492336 2:122382980-122383002 CTGGGTCTGCTAATGCAGGGTGG + Intergenic
937494180 2:122400505-122400527 CTGTGTCTTCACATGGCGGAAGG - Intergenic
937924966 2:127160957-127160979 CTGGGTCTCCAAATTTCAGATGG + Intergenic
937941255 2:127287857-127287879 CTTGATCTTCAAATGGTGGATGG - Intronic
938387046 2:130873962-130873984 CTGGCTCTCCAGATTCAGGAGGG + Intronic
939826094 2:147017222-147017244 CTGTGTCCCCACATGGTGGAAGG + Intergenic
940763320 2:157762483-157762505 TTGGTTCTGCAAATGGTGGAGGG - Intronic
942814945 2:180042032-180042054 CTGGGTCCTCACATGGAAGAAGG - Intergenic
943538706 2:189184569-189184591 CTGGCTTTGCAGATGGAGGAAGG - Intergenic
944364811 2:198905687-198905709 ATGGGTCTCAAATTGGTGGAGGG - Intergenic
944473720 2:200083015-200083037 ATATGTCTCCAAATGGAAGAAGG + Intergenic
945145463 2:206733470-206733492 CTGTGTCTCCACATGGTGGAAGG - Intergenic
946784980 2:223234410-223234432 TAGGGACTCCAAAAGGAGGAAGG + Intergenic
948281544 2:236751088-236751110 CTGTGTCTTCAAATGGTAGAAGG + Intergenic
948295237 2:236855663-236855685 CTGGCTGTGCAGATGGAGGAAGG - Intergenic
948481309 2:238252174-238252196 CTGGGTTTCCAAGGAGAGGAGGG - Intronic
948857077 2:240735219-240735241 CTGGGTCTGAGAAAGGAGGAAGG - Intronic
949037422 2:241822232-241822254 CTGGGTTTGAAGATGGAGGAGGG + Intergenic
1168823689 20:794342-794364 CTGGTCCTCCAGATGGAGGCTGG - Intergenic
1169568472 20:6881511-6881533 CTTGGTCCCCAAATGGGAGAGGG + Intergenic
1169877159 20:10310732-10310754 CTGTGTCCTCACATGGAGGAAGG + Intergenic
1169944645 20:10975625-10975647 CTGTGTCTTCACATGGTGGAAGG + Intergenic
1170300540 20:14879854-14879876 CTGGGTTTCCAAATGGACAGAGG + Intronic
1170382918 20:15781571-15781593 CTGTGTCCCCACATGGTGGAAGG + Intronic
1170547912 20:17450709-17450731 CTGGGTCTTCCCATGGTGGAAGG + Intronic
1170671520 20:18438825-18438847 CTGTGTCTTCATATGGTGGAAGG + Intronic
1171902873 20:30873143-30873165 CTGTGTCCTCAAATGGTGGAAGG - Intergenic
1172226629 20:33309726-33309748 CTGGGTTTCCACAAGGAGGCTGG - Exonic
1174806220 20:53606626-53606648 GGGGATCTCAAAATGGAGGATGG - Intronic
1175048139 20:56126636-56126658 CTGTGTCTTCATATGGTGGAAGG - Intergenic
1175051945 20:56163943-56163965 CTGTGTCACCAGATGGTGGAGGG - Intergenic
1177224183 21:18232453-18232475 CTGTGTCTCCACATGGTGGAAGG + Intronic
1177914273 21:27068879-27068901 CTGGCTTTAAAAATGGAGGAAGG + Intergenic
1178340502 21:31782104-31782126 ATGAGTCTGCAAATGTAGGAAGG - Intergenic
1178608844 21:34062651-34062673 CTGTGTCTTCACATGGTGGAAGG + Intergenic
1178785464 21:35649348-35649370 CTGAGTCACCACCTGGAGGAGGG + Intronic
1178804101 21:35824162-35824184 CTGGCTTTGCAGATGGAGGAAGG + Intronic
1179533933 21:42039318-42039340 CTGTGTCCCCACATGGTGGAGGG + Intergenic
1179722002 21:43321429-43321451 CTGTTTCTCCACATAGAGGATGG + Intergenic
1181324907 22:22037168-22037190 CTGGGTCTTCAAACTGAGGCTGG + Intergenic
1182815392 22:33157888-33157910 CTGGGTCTACAAATCTAGGTTGG - Intergenic
1182820800 22:33214514-33214536 CTGTGTCTCCAAATACATGATGG - Intronic
1182955136 22:34417422-34417444 CTGAGTCCCCACATGGTGGAAGG + Intergenic
1183036291 22:35143269-35143291 CTGAGTCACCACTTGGAGGAGGG + Intergenic
1183579494 22:38715424-38715446 CTGGGCCTGCAGAAGGAGGAAGG - Intronic
1183775685 22:39963313-39963335 CTGGGTCTACAAGGAGAGGATGG - Intronic
1184402678 22:44282889-44282911 CTGGGACACCACATGGAGGCTGG + Intronic
1185214689 22:49591703-49591725 CTGACTTTCCAAAGGGAGGAGGG - Intronic
949118563 3:358261-358283 CTGGCTTTCAAAATGGCGGAAGG - Intronic
949615759 3:5752164-5752186 CTGGATCTCCAGCTTGAGGACGG + Intergenic
949931533 3:9082388-9082410 CTGTGTCTTCACATGGTGGAAGG - Intronic
950402686 3:12782050-12782072 CAGGGGCTCCAAAAGAAGGAGGG + Intergenic
950562592 3:13743385-13743407 CAGGGACTCCAAAAGGAGGAGGG - Intergenic
950699033 3:14727390-14727412 CAGGGGCTCCAGATGGATGATGG - Intronic
952258070 3:31712530-31712552 CTGGCTCTGAAGATGGAGGAAGG + Intronic
954379445 3:50211891-50211913 CTGGGTCTCAAAAAAGAGGATGG - Intronic
954463127 3:50638913-50638935 CTGTGTTTCCTAATGGAGGAGGG - Intronic
954615178 3:51965883-51965905 GTGGGTCTCCTCATGGAAGAGGG + Intronic
955165126 3:56503475-56503497 CTGTGTCTTCACATGGTGGAAGG + Intergenic
957122844 3:76118460-76118482 CTGTTTCTCCAAATGAGGGAGGG + Intronic
957463104 3:80548149-80548171 CTGAGTCTTCATATGGTGGAAGG + Intergenic
958501847 3:94921002-94921024 CTGTGTCCTCAAATGGTGGAAGG - Intergenic
959498907 3:107082596-107082618 CTGGGTTTCTAAATGAAGGTTGG + Intergenic
959585762 3:108023691-108023713 CTGAGTATCCAGATTGAGGAGGG - Intergenic
959787847 3:110321961-110321983 CTGGGTTTTAAAATTGAGGAGGG - Intergenic
959877046 3:111395378-111395400 CTGTGTCTTCACATGGTGGAAGG - Intronic
959886674 3:111510451-111510473 CTGCATCTTCACATGGAGGAAGG + Intronic
960126159 3:114000421-114000443 TTGGGTCTCCAGATGGCAGATGG + Intronic
961144114 3:124579956-124579978 CATGGTCTCCAAAGGGAGGAAGG + Intronic
961689227 3:128656416-128656438 CTGGGTGTTCATATGGAAGAAGG + Intronic
962123978 3:132595097-132595119 CTGGGAGTCCAGATGGATGAGGG + Intronic
962577858 3:136771102-136771124 CTGTGTCCTCATATGGAGGAAGG - Intergenic
963390779 3:144661094-144661116 CTGTGTCTTCACATGGTGGAAGG + Intergenic
963462791 3:145638175-145638197 CTGTGTCTTCACATGGTGGAAGG - Intergenic
963749081 3:149156390-149156412 CTGGGTCTTGAACTGGAGAAGGG - Intronic
964897068 3:161611612-161611634 CTGGCTTTCAATATGGAGGAAGG - Intergenic
966903491 3:184504950-184504972 TTGGTTCTCCCAGTGGAGGAAGG - Intronic
967042408 3:185705753-185705775 CTGTGTCTCTGGATGGAGGAAGG + Intronic
967815375 3:193794030-193794052 CTGGGTCTTCAACTGGAAAATGG - Intergenic
967873273 3:194249676-194249698 CTGGCTCTGCAACTGCAGGAAGG - Intergenic
968716887 4:2166842-2166864 CTGGGTCTCCAGCTTGAAGAAGG + Intronic
968733218 4:2281477-2281499 CTATGTCACCACATGGAGGAAGG + Intronic
969057637 4:4412195-4412217 CTGGTTCCCCACAGGGAGGAGGG + Intronic
969293473 4:6255319-6255341 CTGAGTCACCATGTGGAGGAAGG - Intergenic
969364575 4:6686678-6686700 CTGGGTCAGCACATGCAGGAAGG + Intergenic
969607122 4:8207849-8207871 CTGGCTTTTCAACTGGAGGATGG + Intronic
970207312 4:13667952-13667974 CTGTGTCTCCACATGGTGGAAGG + Intergenic
970550673 4:17177960-17177982 CTGTGTCCTCACATGGAGGAAGG + Intergenic
970638206 4:18033320-18033342 CAGGGTCTCAAAATCAAGGAGGG + Intergenic
970997675 4:22286111-22286133 CTGGCTCTGAAGATGGAGGAAGG - Intergenic
976929811 4:90552007-90552029 CTGTGTCCCCACATGGAGAAAGG + Intronic
977603765 4:98961474-98961496 CTGTGTCTTCACATGGAGGAAGG - Intergenic
978230474 4:106391842-106391864 GTGGGAGGCCAAATGGAGGAGGG - Intergenic
980614588 4:135202332-135202354 CTGTGTCCTCACATGGAGGAAGG - Intergenic
981686538 4:147460729-147460751 CTGGGTCCTCACATGGCGGAAGG - Intergenic
981744859 4:148042913-148042935 CTGCCTCTACAAATTGAGGAGGG - Intronic
981890560 4:149731300-149731322 CTGTGTCTTCACATGGTGGAAGG - Intergenic
981917585 4:150051683-150051705 CTGGGTCCTCACATGGTGGAAGG - Intergenic
982572545 4:157068495-157068517 CTGTGTCTTCACATGGAGGAAGG + Intergenic
983608846 4:169620382-169620404 CTGGGTCTCGAGGAGGAGGAGGG - Intronic
984242391 4:177233273-177233295 CTAGCTTTCAAAATGGAGGAAGG + Intergenic
984716213 4:182927860-182927882 CTATGTCTAGAAATGGAGGATGG - Intergenic
985149572 4:186932615-186932637 ATGTGTCTAAAAATGGAGGAAGG - Intergenic
985940214 5:3129220-3129242 CTGGGTGTCCAAAGGAAGGTTGG - Intergenic
987046762 5:14116047-14116069 CTGGTTCTCCAGCTTGAGGATGG - Intergenic
987051319 5:14148876-14148898 CTGGGTCCCCAGCTGGAGCAAGG + Intronic
987436994 5:17906587-17906609 CTGTGTCTTCACATGGTGGAAGG - Intergenic
987533299 5:19149676-19149698 CGGGGAATCCAAAAGGAGGAAGG + Intergenic
988704929 5:33716194-33716216 CTGTGTCTCCACATGGTAGAAGG - Intronic
989352817 5:40506293-40506315 CTGGGTCTCCAATTTGCAGATGG + Intergenic
989734761 5:44690501-44690523 CTGTGTCCTCACATGGAGGAAGG + Intergenic
991041461 5:62180199-62180221 CTGGGACTCCAAAAGGGGGGAGG + Intergenic
991403538 5:66278792-66278814 CTGGGTCTTCACCTGGTGGAAGG + Intergenic
991473617 5:66996680-66996702 CTGGGCCTGAAGATGGAGGAAGG - Intronic
992845108 5:80738914-80738936 GTGTGTCTTCACATGGAGGAGGG - Intronic
994048273 5:95333230-95333252 TTGGCTCTACAGATGGAGGAAGG + Intergenic
995368344 5:111389176-111389198 CTGTGTCTGCACATGGTGGAAGG + Intronic
995399131 5:111720735-111720757 CTGGGTCTCCAGCTTGAAGATGG + Intronic
995597384 5:113762662-113762684 CTGTGTCCTCAAATAGAGGAAGG + Intergenic
997957003 5:138286553-138286575 CTGGGTGTCCAAAGGGACGATGG + Exonic
998568632 5:143237830-143237852 CTGGGTGTGGAATTGGAGGAGGG + Intergenic
998568646 5:143237876-143237898 CTGGGTGTGGAATTGGAGGAGGG + Intergenic
999122212 5:149218279-149218301 CTGTGTCTCCACATGGTGGAAGG + Intronic
1000073990 5:157767733-157767755 GAGGGTGGCCAAATGGAGGAAGG + Intergenic
1001335618 5:170794410-170794432 CTGCCATTCCAAATGGAGGAGGG - Intronic
1002001129 5:176196810-176196832 CTGGGTGTGCATGTGGAGGAAGG - Intergenic
1002253206 5:177942162-177942184 CTGGGTGTGCATGTGGAGGAAGG + Intergenic
1002442197 5:179270313-179270335 CTGGGTGTCCCAGTGGGGGATGG - Intronic
1003193033 6:3890843-3890865 CTGTGTCTTCACATGGTGGAAGG + Intergenic
1003201459 6:3965088-3965110 CTGTGTCTTCACATGGTGGAAGG - Intergenic
1003794303 6:9582614-9582636 ATGTGTCTGCAAATGGTGGATGG + Intergenic
1004050747 6:12076540-12076562 CTGTGTCTTCACATGGAGGAAGG + Intronic
1005827095 6:29639433-29639455 CTGTGTCTTCACATGGTGGAAGG + Intergenic
1005979779 6:30828121-30828143 CTGGGTCAACAGATGGAGGCAGG + Intergenic
1007464402 6:42041856-42041878 TTTGGGCTCCAGATGGAGGAGGG - Intronic
1007732216 6:43954198-43954220 CTGGGTCTCCTCATGGGGCAGGG + Intergenic
1010662955 6:78592630-78592652 CTGGGTCTCCAGTTTGAAGATGG - Intergenic
1012815901 6:104021571-104021593 CTGGCTTTGCAAATGGAGGAAGG + Intergenic
1015275397 6:131378626-131378648 CTGGGTCTCCAGCTTGCGGATGG + Intergenic
1016341322 6:143064350-143064372 CTGGGTTTGAAGATGGAGGATGG + Intronic
1016355050 6:143209539-143209561 CTGGTTCTGAAGATGGAGGAGGG + Intronic
1017803865 6:157925953-157925975 CTGAGTCCCCACATGGTGGAAGG + Intronic
1018064719 6:160116985-160117007 CTAGGTCTGAAAATGGGGGAGGG + Intergenic
1018334791 6:162775135-162775157 CTGGGTCCCCACATGGTGGAAGG - Intronic
1019256820 7:57580-57602 CTGGGTTTCAGAAGGGAGGATGG + Intergenic
1019659383 7:2215566-2215588 CTGGGTGTGGAGATGGAGGACGG - Intronic
1021744682 7:23726979-23727001 CTGCATCTCCAAAATGAGGAGGG - Intronic
1022260850 7:28703537-28703559 CTGGGTCTCCAGCTGGCAGATGG - Intronic
1022407195 7:30101482-30101504 CTGTGTCCTCACATGGAGGAAGG + Intronic
1023595995 7:41829921-41829943 CTGGATCTGCCAAAGGAGGAAGG - Intergenic
1023770418 7:43551891-43551913 CTGTGTCTTCATGTGGAGGAAGG + Intronic
1025836529 7:65099259-65099281 TTGGGTGGCCAAATGGAGGAAGG + Intergenic
1025906298 7:65788693-65788715 TTGGGTGGCCAAATGGAGGAAGG + Intergenic
1025989056 7:66481348-66481370 TTGGGTGGCCAAGTGGAGGAAGG - Intergenic
1026365748 7:69646702-69646724 CTGGGTCTACAAAAGGAGAGAGG - Intronic
1027212017 7:76157365-76157387 TTGGGTGGCCAAGTGGAGGAAGG - Intergenic
1027695728 7:81407823-81407845 CTGTGTCTTCACATGGTGGAAGG - Intergenic
1028163300 7:87509964-87509986 CTGGTTTTGAAAATGGAGGAAGG + Intronic
1028333673 7:89625788-89625810 TTGGTTCTCCAGATGGAGGCTGG - Intergenic
1028906519 7:96160560-96160582 CTGTGTCCTCACATGGAGGAAGG + Intronic
1029223984 7:99011864-99011886 CTGCTGCTCCAAGTGGAGGAAGG + Intronic
1030776811 7:113543663-113543685 CTGTGTCTTCACATGGTGGAAGG - Intergenic
1030883663 7:114913164-114913186 TAGGGCCTCCAGATGGAGGATGG - Intergenic
1030941212 7:115651627-115651649 CTGTGTCTCCAAATGGCAAAGGG - Intergenic
1030985239 7:116233839-116233861 CTGCATCTTCACATGGAGGAAGG + Intronic
1031305834 7:120125826-120125848 CTGTGTCTTCATATGGAGGAAGG - Intergenic
1032016510 7:128383580-128383602 CTGGTTCTGAAGATGGAGGAAGG + Intergenic
1032357636 7:131225277-131225299 CTGTGTCTCCACATGGTGGAAGG + Intronic
1032429482 7:131849316-131849338 CTAGGAGTCCAAATGGAAGACGG + Intergenic
1034275514 7:149822150-149822172 CTGGGTGTCCAGGTGGAGGAAGG - Intergenic
1034362254 7:150510311-150510333 CTGTGTCCCCACATGGTGGAAGG - Intergenic
1035271337 7:157721807-157721829 CTGGGGCTCCCGCTGGAGGATGG + Intronic
1035642810 8:1196943-1196965 CTGGGTCTCCAGCTTGTGGATGG - Intergenic
1036426953 8:8653874-8653896 CTGGATTTGCAACTGGAGGAGGG - Intergenic
1036993658 8:13629810-13629832 CTGGGTGACCCATTGGAGGAAGG + Intergenic
1037166083 8:15830745-15830767 GGGGGACTCCAAAGGGAGGAAGG + Intergenic
1039218649 8:35302228-35302250 CTGAGTCTCCAAATTGAGATGGG + Intronic
1039220084 8:35320718-35320740 CTGGACATCCAAAGGGAGGAGGG + Intronic
1039836402 8:41259605-41259627 TGGGGACTCCAAAAGGAGGAAGG + Intergenic
1039883481 8:41641933-41641955 CTGTGTCTTCACATGGTGGAAGG + Intergenic
1039997925 8:42550530-42550552 CTGGCTTTGCAGATGGAGGAAGG - Intronic
1040693186 8:49964253-49964275 CTGGCTCCCCACAAGGAGGAGGG + Intronic
1041159801 8:55027997-55028019 CTGTGTCTTCCAATGGAGGAAGG - Intergenic
1041342010 8:56856103-56856125 CTGGCTCTGAAGATGGAGGAAGG - Intergenic
1041721604 8:60981043-60981065 TAGAGCCTCCAAATGGAGGAGGG + Intergenic
1043309445 8:78839830-78839852 TTAGGGATCCAAATGGAGGAAGG - Intergenic
1044888213 8:96803057-96803079 CTGGGTCTCCATCTGGTAGATGG - Intronic
1045683598 8:104688651-104688673 CTGGGTCTCCCCCTGGAGGTAGG - Intronic
1046592322 8:116221198-116221220 CTGTGTCCCCATATGGTGGAAGG - Intergenic
1046601670 8:116324430-116324452 CTGTTTCTCCAAATGGAAAATGG - Intergenic
1046704258 8:117433392-117433414 CTGGCTTTGCAGATGGAGGAAGG - Intergenic
1047251327 8:123183580-123183602 CTGGGGATCAAAATGGAAGAGGG - Intronic
1047298764 8:123594701-123594723 CTGGGTCTTCAAAGGAATGATGG - Intergenic
1047449346 8:124949791-124949813 GTTGGCTTCCAAATGGAGGAAGG + Intergenic
1047874160 8:129116709-129116731 CTGGGTCTCTAAATGGAAGATGG + Intergenic
1048511303 8:135065018-135065040 TTGGCTCCCAAAATGGAGGAAGG - Intergenic
1048616460 8:136080553-136080575 CTGGATTTCCTAATGGAAGAGGG - Intergenic
1050093438 9:2039482-2039504 CTGGGGCTCCTAATGGAGATGGG - Exonic
1053241007 9:36495589-36495611 CTGGATCTGGAAATGAAGGAAGG - Intergenic
1053293590 9:36898090-36898112 CTGGGTTTGGAAATGGAGGATGG + Intronic
1053306363 9:36986947-36986969 CTGGGTGTCCAGAGGGAGGAAGG + Intronic
1053365550 9:37520156-37520178 GTGGGTCGGGAAATGGAGGAAGG - Intronic
1055223095 9:73962735-73962757 CTGGGTCTCCAGATGGCAGATGG - Intergenic
1055921458 9:81465614-81465636 CTGGGTGTTCTAATAGAGGATGG - Intergenic
1056395788 9:86180094-86180116 CTTGGTCTACAAGTGCAGGAGGG + Intergenic
1056735176 9:89203312-89203334 CTGTGTCTTCACATGGAGGAAGG + Intergenic
1056850007 9:90074691-90074713 CTGGTTCTCTAATTGGATGAAGG + Intergenic
1057858770 9:98623636-98623658 CTGGCTTTGAAAATGGAGGAAGG - Intronic
1058600093 9:106659884-106659906 CTGTGTCTTCACATGGTGGAAGG + Intergenic
1059431703 9:114254429-114254451 CTGTTTCTGCCAATGGAGGATGG + Intronic
1060235758 9:121861616-121861638 CTTAGTCTCCAGAAGGAGGAGGG + Intronic
1061272709 9:129552564-129552586 CTGTGTCCTCACATGGAGGAAGG + Intergenic
1062261996 9:135667473-135667495 CTGGAGCTCCCAATGGAGGTGGG - Intergenic
1185845321 X:3432496-3432518 CTGTGTCCCCACATGGTGGAAGG + Intergenic
1185848411 X:3462382-3462404 CTGTGTCTTCAAATGGTGGAAGG + Intergenic
1185938513 X:4286008-4286030 CTGTGTCCTCACATGGAGGAAGG - Intergenic
1186117392 X:6319258-6319280 CTGTGTCTACACATGGTGGAAGG + Intergenic
1186211400 X:7253979-7254001 CTGTGTCTTCACATGGTGGAAGG + Intronic
1186242354 X:7583141-7583163 CTGTGTCTTCACATGGTGGAAGG + Intergenic
1186249702 X:7652513-7652535 CTGGGTCCTTACATGGAGGAAGG - Intergenic
1186313899 X:8348524-8348546 CTGTGTCTTCACATGGTGGAAGG + Intergenic
1186387188 X:9121759-9121781 CTGTGTCTTCACATGGAGGAAGG - Intronic
1186451783 X:9680061-9680083 CTGTGTCTTCACATGGTGGAAGG + Intronic
1186656569 X:11618095-11618117 CTGGCTTTGAAAATGGAGGAAGG + Intronic
1186906619 X:14117951-14117973 CTTGGTCTCCACATGGAGGATGG - Intergenic
1187071644 X:15894214-15894236 CTGTGTCTTCATATGGGGGAAGG + Intergenic
1188760835 X:34027377-34027399 CTGTGTCTACACATGGTGGATGG - Intergenic
1189219949 X:39363014-39363036 CTGTGTCTTCACATGGTGGAAGG - Intergenic
1190002084 X:46698604-46698626 CTGGGTGTCCATATGCAGTAGGG - Intronic
1191250465 X:58257738-58257760 CTGGGTCTTCTCATGGATGATGG + Intergenic
1194083927 X:89502633-89502655 CTGTGTCCCCAAAGGGAAGAAGG - Intergenic
1194827747 X:98583437-98583459 ATGTGTCTCCACATGGCGGAAGG - Intergenic
1195987617 X:110647312-110647334 CTGTGTCCTCAAATGGTGGAAGG - Intergenic
1196630527 X:117934122-117934144 CTGGGATTCTAAAAGGAGGAAGG + Intronic
1197333487 X:125182179-125182201 CTGGCTTTGAAAATGGAGGAAGG - Intergenic
1197405760 X:126047068-126047090 CTGTGTCTTCACATGGTGGAAGG - Intergenic
1197610896 X:128637063-128637085 CTGGCTTTGAAAATGGAGGAAGG - Intergenic
1197788425 X:130224228-130224250 CTGTGTCTTCACATGGGGGAAGG - Intronic
1199763815 X:150926035-150926057 CTGGCTTTGCAGATGGAGGAAGG + Intergenic
1200275612 X:154729558-154729580 CTGGGTCACCAAATGCATGTGGG + Intronic
1200436574 Y:3158513-3158535 CTGTGTCCCCAAAGGGAAGAAGG - Intergenic
1200783488 Y:7238050-7238072 CTGTGTCTTCACATGGTGGAAGG - Intergenic
1200815214 Y:7524423-7524445 CTGTGTCTTCAAATGGTAGAAGG - Intergenic