ID: 1137546184

View in Genome Browser
Species Human (GRCh38)
Location 16:49405227-49405249
Sequence GTACATTCAGAGCCAGGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137546169_1137546184 27 Left 1137546169 16:49405177-49405199 CCCAGGCTGATGGCCCTGGGAGG No data
Right 1137546184 16:49405227-49405249 GTACATTCAGAGCCAGGCCTGGG No data
1137546178_1137546184 -5 Left 1137546178 16:49405209-49405231 CCCACTGCCTCTCCAGTGGTACA No data
Right 1137546184 16:49405227-49405249 GTACATTCAGAGCCAGGCCTGGG No data
1137546171_1137546184 26 Left 1137546171 16:49405178-49405200 CCAGGCTGATGGCCCTGGGAGGC No data
Right 1137546184 16:49405227-49405249 GTACATTCAGAGCCAGGCCTGGG No data
1137546168_1137546184 28 Left 1137546168 16:49405176-49405198 CCCCAGGCTGATGGCCCTGGGAG No data
Right 1137546184 16:49405227-49405249 GTACATTCAGAGCCAGGCCTGGG No data
1137546179_1137546184 -6 Left 1137546179 16:49405210-49405232 CCACTGCCTCTCCAGTGGTACAT No data
Right 1137546184 16:49405227-49405249 GTACATTCAGAGCCAGGCCTGGG No data
1137546174_1137546184 13 Left 1137546174 16:49405191-49405213 CCTGGGAGGCAGGCCCATCCCAC No data
Right 1137546184 16:49405227-49405249 GTACATTCAGAGCCAGGCCTGGG No data
1137546173_1137546184 14 Left 1137546173 16:49405190-49405212 CCCTGGGAGGCAGGCCCATCCCA No data
Right 1137546184 16:49405227-49405249 GTACATTCAGAGCCAGGCCTGGG No data
1137546176_1137546184 -1 Left 1137546176 16:49405205-49405227 CCATCCCACTGCCTCTCCAGTGG No data
Right 1137546184 16:49405227-49405249 GTACATTCAGAGCCAGGCCTGGG No data
1137546175_1137546184 0 Left 1137546175 16:49405204-49405226 CCCATCCCACTGCCTCTCCAGTG No data
Right 1137546184 16:49405227-49405249 GTACATTCAGAGCCAGGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137546184 Original CRISPR GTACATTCAGAGCCAGGCCT GGG Intergenic
No off target data available for this crispr