ID: 1137546861

View in Genome Browser
Species Human (GRCh38)
Location 16:49410795-49410817
Sequence GGTCAGTTGCTGCCCCTTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137546861_1137546866 -2 Left 1137546861 16:49410795-49410817 CCAAGAAGGGGCAGCAACTGACC No data
Right 1137546866 16:49410816-49410838 CCTTCTCTGGAGGAGTCACAGGG No data
1137546861_1137546869 14 Left 1137546861 16:49410795-49410817 CCAAGAAGGGGCAGCAACTGACC No data
Right 1137546869 16:49410832-49410854 CACAGGGGTACTTGCAGAGGTGG No data
1137546861_1137546867 -1 Left 1137546861 16:49410795-49410817 CCAAGAAGGGGCAGCAACTGACC No data
Right 1137546867 16:49410817-49410839 CTTCTCTGGAGGAGTCACAGGGG No data
1137546861_1137546864 -3 Left 1137546861 16:49410795-49410817 CCAAGAAGGGGCAGCAACTGACC No data
Right 1137546864 16:49410815-49410837 ACCTTCTCTGGAGGAGTCACAGG No data
1137546861_1137546868 11 Left 1137546861 16:49410795-49410817 CCAAGAAGGGGCAGCAACTGACC No data
Right 1137546868 16:49410829-49410851 AGTCACAGGGGTACTTGCAGAGG No data
1137546861_1137546870 29 Left 1137546861 16:49410795-49410817 CCAAGAAGGGGCAGCAACTGACC No data
Right 1137546870 16:49410847-49410869 AGAGGTGGTGACATTTGCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137546861 Original CRISPR GGTCAGTTGCTGCCCCTTCT TGG (reversed) Intergenic
No off target data available for this crispr