ID: 1137546866

View in Genome Browser
Species Human (GRCh38)
Location 16:49410816-49410838
Sequence CCTTCTCTGGAGGAGTCACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137546860_1137546866 -1 Left 1137546860 16:49410794-49410816 CCCAAGAAGGGGCAGCAACTGAC No data
Right 1137546866 16:49410816-49410838 CCTTCTCTGGAGGAGTCACAGGG No data
1137546861_1137546866 -2 Left 1137546861 16:49410795-49410817 CCAAGAAGGGGCAGCAACTGACC No data
Right 1137546866 16:49410816-49410838 CCTTCTCTGGAGGAGTCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137546866 Original CRISPR CCTTCTCTGGAGGAGTCACA GGG Intergenic
No off target data available for this crispr