ID: 1137547117

View in Genome Browser
Species Human (GRCh38)
Location 16:49411858-49411880
Sequence TTGGATTCGGGTTGGTTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137547117_1137547130 11 Left 1137547117 16:49411858-49411880 CCCCCAAACCAACCCGAATCCAA No data
Right 1137547130 16:49411892-49411914 CCCTGGCCCCCAAGCTCAGGAGG No data
1137547117_1137547126 8 Left 1137547117 16:49411858-49411880 CCCCCAAACCAACCCGAATCCAA No data
Right 1137547126 16:49411889-49411911 TCCCCCTGGCCCCCAAGCTCAGG No data
1137547117_1137547132 12 Left 1137547117 16:49411858-49411880 CCCCCAAACCAACCCGAATCCAA No data
Right 1137547132 16:49411893-49411915 CCTGGCCCCCAAGCTCAGGAGGG No data
1137547117_1137547124 -6 Left 1137547117 16:49411858-49411880 CCCCCAAACCAACCCGAATCCAA No data
Right 1137547124 16:49411875-49411897 ATCCAAGATAAAATTCCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137547117 Original CRISPR TTGGATTCGGGTTGGTTTGG GGG (reversed) Intergenic
No off target data available for this crispr